Incidental Mutation 'R7678:Ms4a7'
ID592611
Institutional Source Beutler Lab
Gene Symbol Ms4a7
Ensembl Gene ENSMUSG00000024672
Gene Namemembrane-spanning 4-domains, subfamily A, member 7
Synonyms9130422I10Rik, CD20l4, CFFMA, A430103C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7678 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11321039-11336146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11324504 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 185 (F185Y)
Ref Sequence ENSEMBL: ENSMUSP00000025574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025574] [ENSMUST00000056035] [ENSMUST00000067532] [ENSMUST00000159269]
Predicted Effect probably benign
Transcript: ENSMUST00000025574
AA Change: F185Y

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025574
Gene: ENSMUSG00000024672
AA Change: F185Y

DomainStartEndE-ValueType
Pfam:CD20 80 237 4.6e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000056035
AA Change: F133Y

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054830
Gene: ENSMUSG00000024672
AA Change: F133Y

DomainStartEndE-ValueType
transmembrane domain 53 72 N/A INTRINSIC
Pfam:CD20 92 185 3.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067532
AA Change: F152Y

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064534
Gene: ENSMUSG00000024672
AA Change: F152Y

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159269
AA Change: F42Y

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124911
Gene: ENSMUSG00000024672
AA Change: F42Y

DomainStartEndE-ValueType
Pfam:CD20 1 100 1.4e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 C A 5: 8,087,750 probably null Het
Ank1 A G 8: 23,117,058 D1325G probably damaging Het
Asxl1 T C 2: 153,400,652 S1042P probably damaging Het
Bpifb1 C T 2: 154,202,729 H39Y possibly damaging Het
Capn13 C A 17: 73,315,305 M663I probably damaging Het
Clec2g A G 6: 128,979,437 E72G probably damaging Het
Col12a1 T A 9: 79,651,486 Y1899F probably damaging Het
Ctbp2 A G 7: 133,014,624 V194A probably benign Het
Cttnbp2 G T 6: 18,382,810 L1320I probably damaging Het
E2f2 T A 4: 136,192,826 L374* probably null Het
Echdc3 C T 2: 6,212,876 G29S probably benign Het
Ecm1 A G 3: 95,736,182 S269P probably damaging Het
Elmo2 G A 2: 165,291,744 P775S unknown Het
Eno3 T A 11: 70,659,167 probably null Het
Faf1 G A 4: 109,829,864 R267K probably benign Het
Fam162a G A 16: 36,049,937 probably benign Het
Fam178b T A 1: 36,564,451 D473V probably damaging Het
Fat2 G A 11: 55,282,330 T2519I probably damaging Het
Foxc2 A G 8: 121,118,095 Y494C probably damaging Het
Gcnt2 C A 13: 40,953,719 Q355K probably benign Het
Glg1 G T 8: 111,178,865 H595N probably benign Het
Gm9913 A T 2: 125,506,560 H97L unknown Het
Hbegf T A 18: 36,507,548 N152I possibly damaging Het
Hipk1 G A 3: 103,760,550 T567I probably damaging Het
Idh3a C T 9: 54,595,169 P78S probably damaging Het
Igsf10 A T 3: 59,319,340 M2304K possibly damaging Het
Inf2 A G 12: 112,606,994 T723A unknown Het
Itpr2 A T 6: 146,187,550 F2220Y probably benign Het
Kpnb1 C T 11: 97,169,173 R557Q probably damaging Het
Lefty1 A G 1: 180,936,760 D155G probably damaging Het
Lrp1 A G 10: 127,574,053 C1554R probably damaging Het
Lrrc10 A G 10: 117,045,757 D112G probably benign Het
Med12l A G 3: 59,076,720 E439G probably damaging Het
Mtmr6 T A 14: 60,289,652 M234K probably damaging Het
Myh7b C A 2: 155,617,778 probably null Het
Myo1d T C 11: 80,676,893 M254V possibly damaging Het
Nbas T C 12: 13,415,661 V1368A probably damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Neb A G 2: 52,206,702 V4999A probably damaging Het
Npbwr1 G T 1: 5,916,708 Q196K probably benign Het
Nsd3 A T 8: 25,659,817 E339D possibly damaging Het
Olfr738 T C 14: 50,414,014 F157L probably damaging Het
Olfr776 A G 10: 129,261,068 S36G probably damaging Het
Olfr867 T C 9: 20,054,605 N168S probably damaging Het
Oog4 CAA CA 4: 143,437,452 probably null Het
Plxna1 C T 6: 89,331,900 V1199M probably damaging Het
Ppfibp2 T A 7: 107,716,666 M285K probably damaging Het
Ppip5k1 A G 2: 121,337,661 Y704H probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sbspon T C 1: 15,859,058 M170V probably benign Het
Scfd2 A C 5: 74,458,636 F440V probably benign Het
Slc22a19 T A 19: 7,710,937 D86V possibly damaging Het
Smg5 A G 3: 88,353,895 N685S possibly damaging Het
Spata46 A G 1: 170,311,764 R111G possibly damaging Het
Sry A T Y: 2,663,248 D137E possibly damaging Het
Tbkbp1 T C 11: 97,149,483 D35G probably damaging Het
Tcf20 A T 15: 82,851,565 V1895D possibly damaging Het
Tfap4 G T 16: 4,551,766 Q112K possibly damaging Het
Tmem2 C A 19: 21,798,116 T241K probably damaging Het
Trmt10c T A 16: 56,034,939 D111V probably benign Het
Unc80 T C 1: 66,649,722 I2415T probably benign Het
Vmn2r107 A T 17: 20,356,639 M300L probably benign Het
Vmn2r5 A T 3: 64,509,522 F72I probably benign Het
Vmn2r53 T A 7: 12,598,498 H408L probably benign Het
Zan C T 5: 137,463,540 V1126M unknown Het
Zfp493 A T 13: 67,779,695 probably benign Het
Zfp618 C A 4: 63,086,621 A86E probably benign Het
Other mutations in Ms4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Ms4a7 APN 19 11322360 missense probably damaging 0.98
IGL01845:Ms4a7 APN 19 11322387 missense possibly damaging 0.86
IGL02409:Ms4a7 APN 19 11324443 nonsense probably null
R1851:Ms4a7 UTSW 19 11324424 missense probably benign 0.08
R5426:Ms4a7 UTSW 19 11325802 splice site probably null
R5468:Ms4a7 UTSW 19 11322414 missense probably benign 0.39
R6267:Ms4a7 UTSW 19 11333295 missense possibly damaging 0.88
R6756:Ms4a7 UTSW 19 11324525 missense possibly damaging 0.93
R6990:Ms4a7 UTSW 19 11333241 missense probably damaging 0.99
R7260:Ms4a7 UTSW 19 11322346 missense probably damaging 1.00
R7272:Ms4a7 UTSW 19 11333278 nonsense probably null
R7397:Ms4a7 UTSW 19 11321552 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGCATGACCAGAGACTGCTG -3'
(R):5'- ATTGCCGTATAATGGTCAGAGGG -3'

Sequencing Primer
(F):5'- CTGAGAAAGCAGAAACTATCCAAG -3'
(R):5'- ACAGAAAACCCTGTACCAAACTTGTG -3'
Posted On2019-11-12