Mutagenetix > Incidental Mutation

Incidental Mutation 'R7679:Speg'

592614

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e

MMRRC Submission

045707-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7679 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75351941-75408964 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 75382959 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1056 (T1056I)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122] [ENSMUST00000113587] [ENSMUST00000113588] [ENSMUST00000113589] [ENSMUST00000113590] [ENSMUST00000122266]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087122
AA Change: T1056I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: T1056I

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113587

SMART Domains

Protein: ENSMUSP00000109217
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113588

SMART Domains

Protein: ENSMUSP00000109218
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113589

SMART Domains

Protein: ENSMUSP00000109219
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113590

SMART Domains

Protein: ENSMUSP00000109220
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	186	212	N/A	INTRINSIC
low complexity region	219	232	N/A	INTRINSIC
low complexity region	253	262	N/A	INTRINSIC
low complexity region	306	317	N/A	INTRINSIC
low complexity region	467	478	N/A	INTRINSIC
IGc2	633	700	2.19e-9	SMART
low complexity region	752	764	N/A	INTRINSIC
IGc2	780	848	4.03e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000122266

SMART Domains

Protein: ENSMUSP00000113646
Gene: ENSMUSG00000026207

Domain	Start	End	E-Value	Type
low complexity region	4	16	N/A	INTRINSIC
IGc2	32	100	4.03e-8	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	A	C	14: 78,752,256 (GRCm39)	Y206D		Het
Atm	A	T	9: 53,353,797 (GRCm39)	I2906N	probably damaging	Het
B4galnt4	T	C	7: 140,647,678 (GRCm39)	V422A	probably benign	Het
Bod1l	TTCAGGGATC	TTC	5: 41,977,986 (GRCm39)		probably null	Het
Ccar2	G	A	14: 70,376,684 (GRCm39)	Q887*	probably null	Het
Cdh13	A	G	8: 119,963,658 (GRCm39)	I413V	probably benign	Het
Cfap54	A	G	10: 92,803,374 (GRCm39)	V1556A	probably benign	Het
Chchd7	A	T	4: 3,941,297 (GRCm39)	N14Y	probably damaging	Het
Col24a1	C	A	3: 145,105,110 (GRCm39)	T824N	possibly damaging	Het
Col6a3	A	T	1: 90,739,473 (GRCm39)	Y859N	possibly damaging	Het
Dnaaf5	C	T	5: 139,136,392 (GRCm39)	P131S	unknown	Het
Erh	T	C	12: 80,684,345 (GRCm39)	N44S	probably benign	Het
Esm1	T	A	13: 113,346,646 (GRCm39)	D90E	probably damaging	Het
Fbxo44	A	G	4: 148,238,089 (GRCm39)	F213L	probably benign	Het
Flnc	A	G	6: 29,456,789 (GRCm39)	T2262A	probably benign	Het
Fmo9	T	C	1: 166,495,058 (GRCm39)	Q281R	probably benign	Het
Gdpgp1	G	T	7: 79,888,324 (GRCm39)	E118D	probably benign	Het
Gnas	A	T	2: 174,126,624 (GRCm39)	Q53L	probably damaging	Het
Gpr142	G	A	11: 114,697,533 (GRCm39)	V360M	possibly damaging	Het
Grn	A	G	11: 102,323,895 (GRCm39)	D46G	probably benign	Het
H2-T10	A	G	17: 36,430,216 (GRCm39)	F242L	not run	Het
Hgsnat	T	C	8: 26,444,665 (GRCm39)	T428A	probably damaging	Het
Hoxa9	A	G	6: 52,201,288 (GRCm39)	I251T	probably damaging	Het
Inpp5f	C	T	7: 128,296,247 (GRCm39)	T866I	possibly damaging	Het
Itgb1	T	A	8: 129,446,929 (GRCm39)	N481K	probably damaging	Het
Leng9	C	A	7: 4,152,659 (GRCm39)	D6Y	probably benign	Het
Lox	A	C	18: 52,658,178 (GRCm39)	F332V	possibly damaging	Het
Lrp1	G	T	10: 127,424,297 (GRCm39)	Y796*	probably null	Het
Lrrc32	G	A	7: 98,148,894 (GRCm39)	G558D	possibly damaging	Het
Lrrk2	A	G	15: 91,610,389 (GRCm39)	E707G	possibly damaging	Het
Matn4	A	G	2: 164,231,578 (GRCm39)	*625R	probably null	Het
Mcur1	T	A	13: 43,697,959 (GRCm39)	K314*	probably null	Het
Med1	G	C	11: 98,046,887 (GRCm39)	P1303R	unknown	Het
Mgam	T	C	6: 40,619,980 (GRCm39)	L23P	probably damaging	Het
Muc6	G	C	7: 141,217,659 (GRCm39)	P2338R	probably damaging	Het
Nfatc1	T	C	18: 80,651,205 (GRCm39)	I936V	probably benign	Het
Nol11	T	C	11: 107,064,142 (GRCm39)	S557G	probably benign	Het
Palb2	A	G	7: 121,727,237 (GRCm39)	I211T	probably benign	Het
Pard3	T	C	8: 128,098,327 (GRCm39)	V456A	probably benign	Het
Pax2	G	A	19: 44,749,376 (GRCm39)	V40M	probably damaging	Het
Pik3cb	T	C	9: 98,970,660 (GRCm39)	K344E	probably benign	Het
Pik3r3	T	A	4: 116,113,392 (GRCm39)	M45K	probably benign	Het
Plat	G	T	8: 23,262,248 (GRCm39)	G91W	probably damaging	Het
Pot1a	A	G	6: 25,771,633 (GRCm39)	V196A	probably benign	Het
Prkdc	T	A	16: 15,649,183 (GRCm39)	I3719N	probably damaging	Het
Psg16	G	A	7: 16,827,685 (GRCm39)	G123S	probably damaging	Het
Psme4	A	G	11: 30,828,425 (GRCm39)	D1815G	probably damaging	Het
Rpe65	C	T	3: 159,310,030 (GRCm39)	T101I	probably damaging	Het
Rpp25l	A	C	4: 41,712,326 (GRCm39)	C150G	unknown	Het
Saxo4	T	C	19: 10,459,618 (GRCm39)	T30A	probably damaging	Het
Serpina1b	A	T	12: 103,696,774 (GRCm39)	W212R	probably damaging	Het
Slc9a3	G	A	13: 74,308,395 (GRCm39)	R466H	possibly damaging	Het
Sned1	T	C	1: 93,163,760 (GRCm39)	L17P	unknown	Het
Tada1	T	C	1: 166,219,540 (GRCm39)	F281L	probably benign	Het
Tbcd	G	A	11: 121,494,534 (GRCm39)	V1032I	probably benign	Het
Tlr3	A	T	8: 45,852,088 (GRCm39)	S270T	probably benign	Het
Txndc15	G	T	13: 55,873,621 (GRCm39)	R327L	probably damaging	Het
Zfp169	G	C	13: 48,651,859 (GRCm39)	L66V	probably damaging	Het
Zfp442	G	T	2: 150,252,917 (GRCm39)	Y45*	probably null	Het
Zzef1	A	G	11: 72,784,104 (GRCm39)	D2003G	probably benign	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75,387,034 (GRCm39)	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75,387,378 (GRCm39)	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75,386,679 (GRCm39)	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75,364,746 (GRCm39)	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75,404,841 (GRCm39)	missense	probably benign	0.00
IGL01351:Speg	APN	1	75,387,920 (GRCm39)	splice site	probably benign
IGL01473:Speg	APN	1	75,404,929 (GRCm39)	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75,368,541 (GRCm39)	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75,364,471 (GRCm39)	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75,367,734 (GRCm39)	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75,400,031 (GRCm39)	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75,400,559 (GRCm39)	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75,364,831 (GRCm39)	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75,392,241 (GRCm39)	missense	probably benign	0.39
R0112:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75,407,581 (GRCm39)	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75,391,780 (GRCm39)	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75,400,568 (GRCm39)	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75,407,428 (GRCm39)	splice site	probably benign
R0483:Speg	UTSW	1	75,361,676 (GRCm39)	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75,404,622 (GRCm39)	missense	probably benign
R0683:Speg	UTSW	1	75,405,762 (GRCm39)	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75,400,133 (GRCm39)	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75,392,036 (GRCm39)	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75,352,318 (GRCm39)	missense	probably benign	0.00
R0866:Speg	UTSW	1	75,393,727 (GRCm39)	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75,381,705 (GRCm39)	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75,391,782 (GRCm39)	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75,405,739 (GRCm39)	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75,403,739 (GRCm39)	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75,378,145 (GRCm39)	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75,399,516 (GRCm39)	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75,407,104 (GRCm39)	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75,405,128 (GRCm39)	splice site	probably benign
R1505:Speg	UTSW	1	75,352,186 (GRCm39)	missense	probably benign	0.02
R1506:Speg	UTSW	1	75,394,307 (GRCm39)	missense	probably benign	0.03
R1531:Speg	UTSW	1	75,377,866 (GRCm39)	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75,398,595 (GRCm39)	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75,404,691 (GRCm39)	missense	probably benign
R1630:Speg	UTSW	1	75,399,621 (GRCm39)	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75,387,193 (GRCm39)	splice site	probably benign
R1673:Speg	UTSW	1	75,387,807 (GRCm39)	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75,398,388 (GRCm39)	missense	possibly damaging	0.87
R1718:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1719:Speg	UTSW	1	75,394,507 (GRCm39)	missense	probably benign	0.00
R1759:Speg	UTSW	1	75,377,806 (GRCm39)	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75,365,649 (GRCm39)	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75,400,550 (GRCm39)	missense	probably benign
R1936:Speg	UTSW	1	75,408,052 (GRCm39)	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75,394,371 (GRCm39)	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75,407,121 (GRCm39)	missense	probably benign	0.30
R2287:Speg	UTSW	1	75,407,109 (GRCm39)	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75,383,570 (GRCm39)	missense	probably benign	0.27
R2983:Speg	UTSW	1	75,361,574 (GRCm39)	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3112:Speg	UTSW	1	75,399,326 (GRCm39)	nonsense	probably null
R3154:Speg	UTSW	1	75,378,186 (GRCm39)	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75,403,426 (GRCm39)	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75,399,191 (GRCm39)	missense	probably benign	0.27
R4133:Speg	UTSW	1	75,404,548 (GRCm39)	missense	probably benign
R4522:Speg	UTSW	1	75,404,974 (GRCm39)	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75,368,478 (GRCm39)	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75,392,039 (GRCm39)	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75,398,379 (GRCm39)	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75,400,508 (GRCm39)	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75,404,347 (GRCm39)	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75,364,513 (GRCm39)	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75,404,742 (GRCm39)	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75,404,731 (GRCm39)	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75,408,037 (GRCm39)	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75,405,744 (GRCm39)	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75,403,700 (GRCm39)	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75,395,773 (GRCm39)	splice site	probably null
R5985:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75,392,247 (GRCm39)	nonsense	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6038:Speg	UTSW	1	75,395,103 (GRCm39)	critical splice donor site	probably null
R6143:Speg	UTSW	1	75,391,031 (GRCm39)	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75,383,323 (GRCm39)	nonsense	probably null
R6347:Speg	UTSW	1	75,403,519 (GRCm39)	missense	probably benign	0.00
R6453:Speg	UTSW	1	75,394,616 (GRCm39)	missense	probably benign	0.06
R6505:Speg	UTSW	1	75,406,167 (GRCm39)	missense	possibly damaging	0.93
R6505:Speg	UTSW	1	75,383,328 (GRCm39)	missense	possibly damaging	0.94
R6531:Speg	UTSW	1	75,399,401 (GRCm39)	missense	probably benign	0.03
R6566:Speg	UTSW	1	75,365,107 (GRCm39)	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75,387,039 (GRCm39)	critical splice donor site	probably null
R6819:Speg	UTSW	1	75,368,456 (GRCm39)	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75,394,547 (GRCm39)	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75,364,552 (GRCm39)	nonsense	probably null
R6981:Speg	UTSW	1	75,407,557 (GRCm39)	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75,399,912 (GRCm39)	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75,388,091 (GRCm39)	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75,383,414 (GRCm39)	critical splice donor site	probably null
R7175:Speg	UTSW	1	75,399,134 (GRCm39)	missense	probably benign	0.01
R7178:Speg	UTSW	1	75,399,027 (GRCm39)	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75,361,479 (GRCm39)	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75,407,549 (GRCm39)	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75,378,108 (GRCm39)	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75,407,923 (GRCm39)	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75,405,886 (GRCm39)	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75,377,834 (GRCm39)	missense	probably benign	0.04
R7696:Speg	UTSW	1	75,405,805 (GRCm39)	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75,352,469 (GRCm39)	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75,365,514 (GRCm39)	missense	probably benign	0.00
R7824:Speg	UTSW	1	75,360,661 (GRCm39)	splice site	probably null
R7834:Speg	UTSW	1	75,361,571 (GRCm39)	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75,403,810 (GRCm39)	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75,392,065 (GRCm39)	splice site	probably benign
R8068:Speg	UTSW	1	75,398,894 (GRCm39)	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75,391,997 (GRCm39)	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75,392,240 (GRCm39)	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75,399,639 (GRCm39)	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75,395,677 (GRCm39)	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75,398,880 (GRCm39)	missense	probably benign	0.26
R8299:Speg	UTSW	1	75,364,480 (GRCm39)	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75,387,976 (GRCm39)	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75,407,953 (GRCm39)	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75,378,908 (GRCm39)	splice site	probably null
R8781:Speg	UTSW	1	75,383,665 (GRCm39)	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75,381,793 (GRCm39)	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75,404,082 (GRCm39)	critical splice donor site	probably null
R8881:Speg	UTSW	1	75,377,795 (GRCm39)	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75,365,517 (GRCm39)	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75,399,250 (GRCm39)	missense	probably benign	0.30
R9019:Speg	UTSW	1	75,405,882 (GRCm39)	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75,365,076 (GRCm39)	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75,361,654 (GRCm39)	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75,399,378 (GRCm39)	missense	probably benign	0.01
R9117:Speg	UTSW	1	75,364,444 (GRCm39)	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75,367,637 (GRCm39)	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75,361,498 (GRCm39)	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75,398,420 (GRCm39)	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75,394,377 (GRCm39)	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75,399,152 (GRCm39)	missense	probably benign
R9475:Speg	UTSW	1	75,364,735 (GRCm39)	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75,377,768 (GRCm39)	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75,392,380 (GRCm39)	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75,364,447 (GRCm39)	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75,399,426 (GRCm39)	missense	probably benign	0.08
R9553:Speg	UTSW	1	75,394,645 (GRCm39)	missense	probably benign	0.00
R9767:Speg	UTSW	1	75,403,825 (GRCm39)	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75,395,617 (GRCm39)	nonsense	probably null
R9800:Speg	UTSW	1	75,399,358 (GRCm39)	missense	probably benign	0.03
X0025:Speg	UTSW	1	75,399,101 (GRCm39)	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75,400,119 (GRCm39)	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75,383,238 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,404,327 (GRCm39)	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75,407,099 (GRCm39)	missense	probably damaging	0.99
Z1177:Speg	UTSW	1	75,405,025 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCTTAGGAAGAAGGCC -3'
(R):5'- TACTAAGGCAGAGGGACCTG -3'

Sequencing Primer
(F):5'- TCTTAGGAAGAAGGCCTGGCC -3'
(R):5'- ATCACACCCATGATGTTTTCTCAG -3'

Posted On

2019-11-12