Incidental Mutation 'R7679:Zfp442'
ID 592619
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7679 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 150410997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 45 (Y45*)
Ref Sequence ENSEMBL: ENSMUSP00000105542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect probably null
Transcript: ENSMUST00000109916
AA Change: Y45*
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: Y45*

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185796
AA Change: Y44*
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: Y44*

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,514,816 Y206D Het
Atm A T 9: 53,442,497 I2906N probably damaging Het
B4galnt4 T C 7: 141,067,765 V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,820,643 probably null Het
Ccar2 G A 14: 70,139,235 Q887* probably null Het
Cdh13 A G 8: 119,236,919 I413V probably benign Het
Cfap54 A G 10: 92,967,512 V1556A probably benign Het
Chchd7 A T 4: 3,941,297 N14Y probably damaging Het
Col24a1 C A 3: 145,399,355 T824N possibly damaging Het
Col6a3 A T 1: 90,811,751 Y859N possibly damaging Het
Dnaaf5 C T 5: 139,150,637 P131S unknown Het
Erh T C 12: 80,637,571 N44S probably benign Het
Esm1 T A 13: 113,210,112 D90E probably damaging Het
Fbxo44 A G 4: 148,153,632 F213L probably benign Het
Flnc A G 6: 29,456,790 T2262A probably benign Het
Fmo9 T C 1: 166,667,489 Q281R probably benign Het
Gdpgp1 G T 7: 80,238,576 E118D probably benign Het
Gnas A T 2: 174,284,831 Q53L probably damaging Het
Gpr142 G A 11: 114,806,707 V360M possibly damaging Het
Grn A G 11: 102,433,069 D46G probably benign Het
H2-T10 A G 17: 36,119,324 F242L not run Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Hoxa9 A G 6: 52,224,308 I251T probably damaging Het
Inpp5f C T 7: 128,694,523 T866I possibly damaging Het
Itgb1 T A 8: 128,720,448 N481K probably damaging Het
Leng9 C A 7: 4,149,660 D6Y probably benign Het
Lox A C 18: 52,525,106 F332V possibly damaging Het
Lrp1 G T 10: 127,588,428 Y796* probably null Het
Lrrc32 G A 7: 98,499,687 G558D possibly damaging Het
Lrrk2 A G 15: 91,726,186 E707G possibly damaging Het
Matn4 A G 2: 164,389,658 *625R probably null Het
Mcur1 T A 13: 43,544,483 K314* probably null Het
Med1 G C 11: 98,156,061 P1303R unknown Het
Mgam T C 6: 40,643,046 L23P probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nfatc1 T C 18: 80,607,990 I936V probably benign Het
Nol11 T C 11: 107,173,316 S557G probably benign Het
Palb2 A G 7: 122,128,014 I211T probably benign Het
Pard3 T C 8: 127,371,846 V456A probably benign Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pik3cb T C 9: 99,088,607 K344E probably benign Het
Pik3r3 T A 4: 116,256,195 M45K probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pot1a A G 6: 25,771,634 V196A probably benign Het
Ppp1r32 T C 19: 10,482,254 T30A probably damaging Het
Prkdc T A 16: 15,831,319 I3719N probably damaging Het
Psg16 G A 7: 17,093,760 G123S probably damaging Het
Psme4 A G 11: 30,878,425 D1815G probably damaging Het
Rpe65 C T 3: 159,604,393 T101I probably damaging Het
Rpp25l A C 4: 41,712,326 C150G unknown Het
Serpina1b A T 12: 103,730,515 W212R probably damaging Het
Slc9a3 G A 13: 74,160,276 R466H possibly damaging Het
Sned1 T C 1: 93,236,038 L17P unknown Het
Speg C T 1: 75,406,315 T1056I probably damaging Het
Tada1 T C 1: 166,391,971 F281L probably benign Het
Tbcd G A 11: 121,603,708 V1032I probably benign Het
Tlr3 A T 8: 45,399,051 S270T probably benign Het
Txndc15 G T 13: 55,725,808 R327L probably damaging Het
Zfp169 G C 13: 48,498,383 L66V probably damaging Het
Zzef1 A G 11: 72,893,278 D2003G probably benign Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R8528:Zfp442 UTSW 2 150409042 missense probably damaging 1.00
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9269:Zfp442 UTSW 2 150409367 missense probably benign 0.19
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9401:Zfp442 UTSW 2 150409695 missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150408748 missense unknown
R9711:Zfp442 UTSW 2 150408287 missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGTCTTTGCACGTAGAGGAA -3'
(R):5'- AGGGTGTTGTGACCTATGATGAT -3'

Sequencing Primer
(F):5'- CTTTGCACGTAGAGGAATGCTGC -3'
(R):5'- CTGGAGACCTACAGGAATCTTGC -3'
Posted On 2019-11-12