Incidental Mutation 'R7679:Matn4'
ID592620
Institutional Source Beutler Lab
Gene Symbol Matn4
Ensembl Gene ENSMUSG00000016995
Gene Namematrilin 4
Synonymsmatrilin-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7679 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164389393-164405160 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 164389658 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 625 (*625R)
Ref Sequence ENSEMBL: ENSMUSP00000099392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103103] [ENSMUST00000103104] [ENSMUST00000109358] [ENSMUST00000109359] [ENSMUST00000167427]
Predicted Effect probably null
Transcript: ENSMUST00000103103
AA Change: *625R
SMART Domains Protein: ENSMUSP00000099392
Gene: ENSMUSG00000016995
AA Change: *625R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103104
AA Change: *625R
SMART Domains Protein: ENSMUSP00000099393
Gene: ENSMUSG00000016995
AA Change: *625R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109358
AA Change: *543R
SMART Domains Protein: ENSMUSP00000104982
Gene: ENSMUSG00000016995
AA Change: *543R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.85e0 SMART
EGF 261 298 1.24e-1 SMART
VWA 304 482 6.72e-56 SMART
Matrilin_ccoil 492 539 2.39e-14 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109359
AA Change: *584R
SMART Domains Protein: ENSMUSP00000104983
Gene: ENSMUSG00000016995
AA Change: *584R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 3.43e-4 SMART
EGF 261 298 1.85e0 SMART
EGF 302 339 1.24e-1 SMART
VWA 345 523 6.72e-56 SMART
Matrilin_ccoil 533 580 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167427
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,514,816 Y206D Het
Atm A T 9: 53,442,497 I2906N probably damaging Het
B4galnt4 T C 7: 141,067,765 V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,820,643 probably null Het
Ccar2 G A 14: 70,139,235 Q887* probably null Het
Cdh13 A G 8: 119,236,919 I413V probably benign Het
Cfap54 A G 10: 92,967,512 V1556A probably benign Het
Chchd7 A T 4: 3,941,297 N14Y probably damaging Het
Col24a1 C A 3: 145,399,355 T824N possibly damaging Het
Col6a3 A T 1: 90,811,751 Y859N possibly damaging Het
Dnaaf5 C T 5: 139,150,637 P131S unknown Het
Erh T C 12: 80,637,571 N44S probably benign Het
Esm1 T A 13: 113,210,112 D90E probably damaging Het
Fbxo44 A G 4: 148,153,632 F213L probably benign Het
Flnc A G 6: 29,456,790 T2262A probably benign Het
Fmo9 T C 1: 166,667,489 Q281R probably benign Het
Gdpgp1 G T 7: 80,238,576 E118D probably benign Het
Gnas A T 2: 174,284,831 Q53L probably damaging Het
Gpr142 G A 11: 114,806,707 V360M possibly damaging Het
Grn A G 11: 102,433,069 D46G probably benign Het
H2-T10 A G 17: 36,119,324 F242L not run Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Hoxa9 A G 6: 52,224,308 I251T probably damaging Het
Inpp5f C T 7: 128,694,523 T866I possibly damaging Het
Itgb1 T A 8: 128,720,448 N481K probably damaging Het
Leng9 C A 7: 4,149,660 D6Y probably benign Het
Lox A C 18: 52,525,106 F332V possibly damaging Het
Lrp1 G T 10: 127,588,428 Y796* probably null Het
Lrrc32 G A 7: 98,499,687 G558D possibly damaging Het
Lrrk2 A G 15: 91,726,186 E707G possibly damaging Het
Mcur1 T A 13: 43,544,483 K314* probably null Het
Med1 G C 11: 98,156,061 P1303R unknown Het
Mgam T C 6: 40,643,046 L23P probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nfatc1 T C 18: 80,607,990 I936V probably benign Het
Nol11 T C 11: 107,173,316 S557G probably benign Het
Palb2 A G 7: 122,128,014 I211T probably benign Het
Pard3 T C 8: 127,371,846 V456A probably benign Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pik3cb T C 9: 99,088,607 K344E probably benign Het
Pik3r3 T A 4: 116,256,195 M45K probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pot1a A G 6: 25,771,634 V196A probably benign Het
Ppp1r32 T C 19: 10,482,254 T30A probably damaging Het
Prkdc T A 16: 15,831,319 I3719N probably damaging Het
Psg16 G A 7: 17,093,760 G123S probably damaging Het
Psme4 A G 11: 30,878,425 D1815G probably damaging Het
Rpe65 C T 3: 159,604,393 T101I probably damaging Het
Rpp25l A C 4: 41,712,326 C150G unknown Het
Serpina1b A T 12: 103,730,515 W212R probably damaging Het
Slc9a3 G A 13: 74,160,276 R466H possibly damaging Het
Sned1 T C 1: 93,236,038 L17P unknown Het
Speg C T 1: 75,406,315 T1056I probably damaging Het
Tada1 T C 1: 166,391,971 F281L probably benign Het
Tbcd G A 11: 121,603,708 V1032I probably benign Het
Tlr3 A T 8: 45,399,051 S270T probably benign Het
Txndc15 G T 13: 55,725,808 R327L probably damaging Het
Zfp169 G C 13: 48,498,383 L66V probably damaging Het
Zfp442 G T 2: 150,410,997 Y45* probably null Het
Zzef1 A G 11: 72,893,278 D2003G probably benign Het
Other mutations in Matn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Matn4 APN 2 164400743 missense probably damaging 0.97
IGL02188:Matn4 APN 2 164400866 missense probably benign 0.00
IGL02195:Matn4 APN 2 164401052 missense probably damaging 1.00
IGL02696:Matn4 APN 2 164396838 missense probably benign 0.09
IGL02927:Matn4 APN 2 164389837 missense probably damaging 1.00
R2021:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2022:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2272:Matn4 UTSW 2 164397242 missense possibly damaging 0.92
R2448:Matn4 UTSW 2 164401850 missense probably benign 0.04
R4824:Matn4 UTSW 2 164393231 missense probably benign 0.01
R4839:Matn4 UTSW 2 164400976 missense probably benign 0.00
R5884:Matn4 UTSW 2 164404608 utr 5 prime probably benign
R5914:Matn4 UTSW 2 164393224 missense probably damaging 1.00
R6209:Matn4 UTSW 2 164400815 missense probably damaging 1.00
R6995:Matn4 UTSW 2 164389664 nonsense probably null
R8035:Matn4 UTSW 2 164397040 missense probably damaging 0.99
X0063:Matn4 UTSW 2 164397277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCTGCCAGCATAGCAATAGC -3'
(R):5'- TTGGCTCTCTCCTTGCAGAG -3'

Sequencing Primer
(F):5'- GCGAGTGTAGCAGTCCTTC -3'
(R):5'- CGAAAGCCTCGTGGAGTTC -3'
Posted On2019-11-12