Incidental Mutation 'R7679:Rpe65'
ID 592623
Institutional Source Beutler Lab
Gene Symbol Rpe65
Ensembl Gene ENSMUSG00000028174
Gene Name retinal pigment epithelium 65
Synonyms A930029L06Rik, Mord1, rd12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock # R7679 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 159599175-159625321 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 159604393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 101 (T101I)
Ref Sequence ENSEMBL: ENSMUSP00000029824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]
AlphaFold Q91ZQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000029824
AA Change: T101I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: T101I

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196999
AA Change: T101I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: T101I

DomainStartEndE-ValueType
Pfam:RPE65 15 532 1.4e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197771
SMART Domains Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174

DomainStartEndE-ValueType
Pfam:RPE65 13 109 5.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,514,816 Y206D Het
Atm A T 9: 53,442,497 I2906N probably damaging Het
B4galnt4 T C 7: 141,067,765 V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,820,643 probably null Het
Ccar2 G A 14: 70,139,235 Q887* probably null Het
Cdh13 A G 8: 119,236,919 I413V probably benign Het
Cfap54 A G 10: 92,967,512 V1556A probably benign Het
Chchd7 A T 4: 3,941,297 N14Y probably damaging Het
Col24a1 C A 3: 145,399,355 T824N possibly damaging Het
Col6a3 A T 1: 90,811,751 Y859N possibly damaging Het
Dnaaf5 C T 5: 139,150,637 P131S unknown Het
Erh T C 12: 80,637,571 N44S probably benign Het
Esm1 T A 13: 113,210,112 D90E probably damaging Het
Fbxo44 A G 4: 148,153,632 F213L probably benign Het
Flnc A G 6: 29,456,790 T2262A probably benign Het
Fmo9 T C 1: 166,667,489 Q281R probably benign Het
Gdpgp1 G T 7: 80,238,576 E118D probably benign Het
Gnas A T 2: 174,284,831 Q53L probably damaging Het
Gpr142 G A 11: 114,806,707 V360M possibly damaging Het
Grn A G 11: 102,433,069 D46G probably benign Het
H2-T10 A G 17: 36,119,324 F242L not run Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Hoxa9 A G 6: 52,224,308 I251T probably damaging Het
Inpp5f C T 7: 128,694,523 T866I possibly damaging Het
Itgb1 T A 8: 128,720,448 N481K probably damaging Het
Leng9 C A 7: 4,149,660 D6Y probably benign Het
Lox A C 18: 52,525,106 F332V possibly damaging Het
Lrp1 G T 10: 127,588,428 Y796* probably null Het
Lrrc32 G A 7: 98,499,687 G558D possibly damaging Het
Lrrk2 A G 15: 91,726,186 E707G possibly damaging Het
Matn4 A G 2: 164,389,658 *625R probably null Het
Mcur1 T A 13: 43,544,483 K314* probably null Het
Med1 G C 11: 98,156,061 P1303R unknown Het
Mgam T C 6: 40,643,046 L23P probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nfatc1 T C 18: 80,607,990 I936V probably benign Het
Nol11 T C 11: 107,173,316 S557G probably benign Het
Palb2 A G 7: 122,128,014 I211T probably benign Het
Pard3 T C 8: 127,371,846 V456A probably benign Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pik3cb T C 9: 99,088,607 K344E probably benign Het
Pik3r3 T A 4: 116,256,195 M45K probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pot1a A G 6: 25,771,634 V196A probably benign Het
Ppp1r32 T C 19: 10,482,254 T30A probably damaging Het
Prkdc T A 16: 15,831,319 I3719N probably damaging Het
Psg16 G A 7: 17,093,760 G123S probably damaging Het
Psme4 A G 11: 30,878,425 D1815G probably damaging Het
Rpp25l A C 4: 41,712,326 C150G unknown Het
Serpina1b A T 12: 103,730,515 W212R probably damaging Het
Slc9a3 G A 13: 74,160,276 R466H possibly damaging Het
Sned1 T C 1: 93,236,038 L17P unknown Het
Speg C T 1: 75,406,315 T1056I probably damaging Het
Tada1 T C 1: 166,391,971 F281L probably benign Het
Tbcd G A 11: 121,603,708 V1032I probably benign Het
Tlr3 A T 8: 45,399,051 S270T probably benign Het
Txndc15 G T 13: 55,725,808 R327L probably damaging Het
Zfp169 G C 13: 48,498,383 L66V probably damaging Het
Zfp442 G T 2: 150,410,997 Y45* probably null Het
Zzef1 A G 11: 72,893,278 D2003G probably benign Het
Other mutations in Rpe65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rpe65 APN 3 159614542 missense probably damaging 0.99
IGL01446:Rpe65 APN 3 159600405 splice site probably benign
IGL01815:Rpe65 APN 3 159604530 splice site probably null
IGL02085:Rpe65 APN 3 159615646 missense probably benign 0.00
IGL02232:Rpe65 APN 3 159604351 missense possibly damaging 0.93
IGL02248:Rpe65 APN 3 159624705 missense probably damaging 1.00
IGL02645:Rpe65 APN 3 159606491 missense probably damaging 0.99
IGL02711:Rpe65 APN 3 159622877 missense possibly damaging 0.84
IGL02982:Rpe65 APN 3 159600361 missense probably damaging 0.99
IGL03280:Rpe65 APN 3 159604341 missense probably damaging 0.96
IGL03350:Rpe65 APN 3 159614517 missense possibly damaging 0.75
IGL03356:Rpe65 APN 3 159615577 missense possibly damaging 0.89
I1329:Rpe65 UTSW 3 159624723 missense probably benign 0.35
R0571:Rpe65 UTSW 3 159600349 missense probably damaging 1.00
R0905:Rpe65 UTSW 3 159601583 missense possibly damaging 0.95
R1024:Rpe65 UTSW 3 159606485 missense probably benign 0.07
R1597:Rpe65 UTSW 3 159614784 missense probably damaging 0.97
R1657:Rpe65 UTSW 3 159614448 missense probably damaging 0.97
R1778:Rpe65 UTSW 3 159622848 missense probably damaging 1.00
R1970:Rpe65 UTSW 3 159615670 missense probably benign
R2259:Rpe65 UTSW 3 159615571 missense probably damaging 1.00
R3012:Rpe65 UTSW 3 159604563 missense possibly damaging 0.61
R3923:Rpe65 UTSW 3 159604400 missense probably benign 0.16
R3975:Rpe65 UTSW 3 159604585 missense probably damaging 1.00
R4204:Rpe65 UTSW 3 159604410 missense probably damaging 0.99
R4825:Rpe65 UTSW 3 159624681 missense probably benign
R4924:Rpe65 UTSW 3 159622631 missense probably benign 0.01
R5269:Rpe65 UTSW 3 159604347 missense probably benign 0.07
R5324:Rpe65 UTSW 3 159604404 missense possibly damaging 0.94
R5441:Rpe65 UTSW 3 159604401 missense probably damaging 1.00
R5854:Rpe65 UTSW 3 159615676 missense probably benign
R5907:Rpe65 UTSW 3 159615682 critical splice donor site probably null
R6149:Rpe65 UTSW 3 159614143 missense probably benign
R6660:Rpe65 UTSW 3 159614708 missense probably damaging 0.98
R6830:Rpe65 UTSW 3 159614168 missense probably benign 0.06
R7025:Rpe65 UTSW 3 159622685 missense probably damaging 1.00
R7092:Rpe65 UTSW 3 159615591 missense probably damaging 1.00
R7203:Rpe65 UTSW 3 159622854 missense probably damaging 0.99
R7366:Rpe65 UTSW 3 159624729 missense probably benign 0.13
R7537:Rpe65 UTSW 3 159604609 missense probably damaging 0.98
R8044:Rpe65 UTSW 3 159614705 missense probably benign
R8179:Rpe65 UTSW 3 159624699 missense probably benign 0.06
R8409:Rpe65 UTSW 3 159614148 missense probably benign 0.01
R8558:Rpe65 UTSW 3 159614792 missense probably damaging 1.00
R9042:Rpe65 UTSW 3 159615655 missense probably damaging 1.00
R9483:Rpe65 UTSW 3 159622681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTTCGGAGCCTCAGTC -3'
(R):5'- ACTGGGTAGATATTTACAAGGGC -3'

Sequencing Primer
(F):5'- CTCTCTATCACCGGCTTGGGG -3'
(R):5'- AGGGCATTGTCAGTAACCTC -3'
Posted On 2019-11-12