Incidental Mutation 'R7679:Rpp25l'
ID592625
Institutional Source Beutler Lab
Gene Symbol Rpp25l
Ensembl Gene ENSMUSG00000036114
Gene Nameribonuclease P/MRP 25 subunit-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R7679 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41712033-41713534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 41712326 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 150 (C150G)
Ref Sequence ENSEMBL: ENSMUSP00000041477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030158] [ENSMUST00000038434] [ENSMUST00000108041] [ENSMUST00000171641]
Predicted Effect probably benign
Transcript: ENSMUST00000030158
SMART Domains Protein: ENSMUSP00000030158
Gene: ENSMUSG00000028447

DomainStartEndE-ValueType
Pfam:Dynactin_p22 6 170 2.8e-61 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000038434
AA Change: C150G
SMART Domains Protein: ENSMUSP00000041477
Gene: ENSMUSG00000036114
AA Change: C150G

DomainStartEndE-ValueType
Pfam:Alba 26 90 8.2e-16 PFAM
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171641
SMART Domains Protein: ENSMUSP00000130988
Gene: ENSMUSG00000028447

DomainStartEndE-ValueType
Pfam:Dynactin_p22 1 149 1.4e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. Members of this family are small archaebacterial proteins with no known function. Alternative splicing has been observed at this locus and two variants, both encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,514,816 Y206D Het
Atm A T 9: 53,442,497 I2906N probably damaging Het
B4galnt4 T C 7: 141,067,765 V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,820,643 probably null Het
Ccar2 G A 14: 70,139,235 Q887* probably null Het
Cdh13 A G 8: 119,236,919 I413V probably benign Het
Cfap54 A G 10: 92,967,512 V1556A probably benign Het
Chchd7 A T 4: 3,941,297 N14Y probably damaging Het
Col24a1 C A 3: 145,399,355 T824N possibly damaging Het
Col6a3 A T 1: 90,811,751 Y859N possibly damaging Het
Dnaaf5 C T 5: 139,150,637 P131S unknown Het
Erh T C 12: 80,637,571 N44S probably benign Het
Esm1 T A 13: 113,210,112 D90E probably damaging Het
Fbxo44 A G 4: 148,153,632 F213L probably benign Het
Flnc A G 6: 29,456,790 T2262A probably benign Het
Fmo9 T C 1: 166,667,489 Q281R probably benign Het
Gdpgp1 G T 7: 80,238,576 E118D probably benign Het
Gnas A T 2: 174,284,831 Q53L probably damaging Het
Gpr142 G A 11: 114,806,707 V360M possibly damaging Het
Grn A G 11: 102,433,069 D46G probably benign Het
H2-T10 A G 17: 36,119,324 F242L not run Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Hoxa9 A G 6: 52,224,308 I251T probably damaging Het
Inpp5f C T 7: 128,694,523 T866I possibly damaging Het
Itgb1 T A 8: 128,720,448 N481K probably damaging Het
Leng9 C A 7: 4,149,660 D6Y probably benign Het
Lox A C 18: 52,525,106 F332V possibly damaging Het
Lrp1 G T 10: 127,588,428 Y796* probably null Het
Lrrc32 G A 7: 98,499,687 G558D possibly damaging Het
Lrrk2 A G 15: 91,726,186 E707G possibly damaging Het
Matn4 A G 2: 164,389,658 *625R probably null Het
Mcur1 T A 13: 43,544,483 K314* probably null Het
Med1 G C 11: 98,156,061 P1303R unknown Het
Mgam T C 6: 40,643,046 L23P probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nfatc1 T C 18: 80,607,990 I936V probably benign Het
Nol11 T C 11: 107,173,316 S557G probably benign Het
Palb2 A G 7: 122,128,014 I211T probably benign Het
Pard3 T C 8: 127,371,846 V456A probably benign Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pik3cb T C 9: 99,088,607 K344E probably benign Het
Pik3r3 T A 4: 116,256,195 M45K probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pot1a A G 6: 25,771,634 V196A probably benign Het
Ppp1r32 T C 19: 10,482,254 T30A probably damaging Het
Prkdc T A 16: 15,831,319 I3719N probably damaging Het
Psg16 G A 7: 17,093,760 G123S probably damaging Het
Psme4 A G 11: 30,878,425 D1815G probably damaging Het
Rpe65 C T 3: 159,604,393 T101I probably damaging Het
Serpina1b A T 12: 103,730,515 W212R probably damaging Het
Slc9a3 G A 13: 74,160,276 R466H possibly damaging Het
Sned1 T C 1: 93,236,038 L17P unknown Het
Speg C T 1: 75,406,315 T1056I probably damaging Het
Tada1 T C 1: 166,391,971 F281L probably benign Het
Tbcd G A 11: 121,603,708 V1032I probably benign Het
Tlr3 A T 8: 45,399,051 S270T probably benign Het
Txndc15 G T 13: 55,725,808 R327L probably damaging Het
Zfp169 G C 13: 48,498,383 L66V probably damaging Het
Zfp442 G T 2: 150,410,997 Y45* probably null Het
Zzef1 A G 11: 72,893,278 D2003G probably benign Het
Other mutations in Rpp25l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03196:Rpp25l APN 4 41712541 missense possibly damaging 0.65
R1742:Rpp25l UTSW 4 41712763 missense probably damaging 1.00
R5768:Rpp25l UTSW 4 41712649 missense probably damaging 0.98
R5858:Rpp25l UTSW 4 41712678 missense probably benign 0.01
R7570:Rpp25l UTSW 4 41712529 missense probably damaging 1.00
R7593:Rpp25l UTSW 4 41712305 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTCTTTAACTCAGCACTGACC -3'
(R):5'- AAGCTCCGCTTCCTGCAAAC -3'

Sequencing Primer
(F):5'- GACCCACGCCAGTCTTTTTAACAG -3'
(R):5'- TTCCTGCAAACGGAGGAC -3'
Posted On2019-11-12