Incidental Mutation 'R7679:Bod1l'
ID 592628
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Name biorientation of chromosomes in cell division 1-like
Synonyms A230054D04Rik
MMRRC Submission 045707-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R7679 (G1)
Quality Score 217.468
Status Not validated
Chromosome 5
Chromosomal Location 41944881-42001658 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TTCAGGGATC to TTC at 41977986 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000050556
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202908
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,752,256 (GRCm39) Y206D Het
Atm A T 9: 53,353,797 (GRCm39) I2906N probably damaging Het
B4galnt4 T C 7: 140,647,678 (GRCm39) V422A probably benign Het
Ccar2 G A 14: 70,376,684 (GRCm39) Q887* probably null Het
Cdh13 A G 8: 119,963,658 (GRCm39) I413V probably benign Het
Cfap54 A G 10: 92,803,374 (GRCm39) V1556A probably benign Het
Chchd7 A T 4: 3,941,297 (GRCm39) N14Y probably damaging Het
Col24a1 C A 3: 145,105,110 (GRCm39) T824N possibly damaging Het
Col6a3 A T 1: 90,739,473 (GRCm39) Y859N possibly damaging Het
Dnaaf5 C T 5: 139,136,392 (GRCm39) P131S unknown Het
Erh T C 12: 80,684,345 (GRCm39) N44S probably benign Het
Esm1 T A 13: 113,346,646 (GRCm39) D90E probably damaging Het
Fbxo44 A G 4: 148,238,089 (GRCm39) F213L probably benign Het
Flnc A G 6: 29,456,789 (GRCm39) T2262A probably benign Het
Fmo9 T C 1: 166,495,058 (GRCm39) Q281R probably benign Het
Gdpgp1 G T 7: 79,888,324 (GRCm39) E118D probably benign Het
Gnas A T 2: 174,126,624 (GRCm39) Q53L probably damaging Het
Gpr142 G A 11: 114,697,533 (GRCm39) V360M possibly damaging Het
Grn A G 11: 102,323,895 (GRCm39) D46G probably benign Het
H2-T10 A G 17: 36,430,216 (GRCm39) F242L not run Het
Hgsnat T C 8: 26,444,665 (GRCm39) T428A probably damaging Het
Hoxa9 A G 6: 52,201,288 (GRCm39) I251T probably damaging Het
Inpp5f C T 7: 128,296,247 (GRCm39) T866I possibly damaging Het
Itgb1 T A 8: 129,446,929 (GRCm39) N481K probably damaging Het
Leng9 C A 7: 4,152,659 (GRCm39) D6Y probably benign Het
Lox A C 18: 52,658,178 (GRCm39) F332V possibly damaging Het
Lrp1 G T 10: 127,424,297 (GRCm39) Y796* probably null Het
Lrrc32 G A 7: 98,148,894 (GRCm39) G558D possibly damaging Het
Lrrk2 A G 15: 91,610,389 (GRCm39) E707G possibly damaging Het
Matn4 A G 2: 164,231,578 (GRCm39) *625R probably null Het
Mcur1 T A 13: 43,697,959 (GRCm39) K314* probably null Het
Med1 G C 11: 98,046,887 (GRCm39) P1303R unknown Het
Mgam T C 6: 40,619,980 (GRCm39) L23P probably damaging Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Nfatc1 T C 18: 80,651,205 (GRCm39) I936V probably benign Het
Nol11 T C 11: 107,064,142 (GRCm39) S557G probably benign Het
Palb2 A G 7: 121,727,237 (GRCm39) I211T probably benign Het
Pard3 T C 8: 128,098,327 (GRCm39) V456A probably benign Het
Pax2 G A 19: 44,749,376 (GRCm39) V40M probably damaging Het
Pik3cb T C 9: 98,970,660 (GRCm39) K344E probably benign Het
Pik3r3 T A 4: 116,113,392 (GRCm39) M45K probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pot1a A G 6: 25,771,633 (GRCm39) V196A probably benign Het
Prkdc T A 16: 15,649,183 (GRCm39) I3719N probably damaging Het
Psg16 G A 7: 16,827,685 (GRCm39) G123S probably damaging Het
Psme4 A G 11: 30,828,425 (GRCm39) D1815G probably damaging Het
Rpe65 C T 3: 159,310,030 (GRCm39) T101I probably damaging Het
Rpp25l A C 4: 41,712,326 (GRCm39) C150G unknown Het
Saxo4 T C 19: 10,459,618 (GRCm39) T30A probably damaging Het
Serpina1b A T 12: 103,696,774 (GRCm39) W212R probably damaging Het
Slc9a3 G A 13: 74,308,395 (GRCm39) R466H possibly damaging Het
Sned1 T C 1: 93,163,760 (GRCm39) L17P unknown Het
Speg C T 1: 75,382,959 (GRCm39) T1056I probably damaging Het
Tada1 T C 1: 166,219,540 (GRCm39) F281L probably benign Het
Tbcd G A 11: 121,494,534 (GRCm39) V1032I probably benign Het
Tlr3 A T 8: 45,852,088 (GRCm39) S270T probably benign Het
Txndc15 G T 13: 55,873,621 (GRCm39) R327L probably damaging Het
Zfp169 G C 13: 48,651,859 (GRCm39) L66V probably damaging Het
Zfp442 G T 2: 150,252,917 (GRCm39) Y45* probably null Het
Zzef1 A G 11: 72,784,104 (GRCm39) D2003G probably benign Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41,974,166 (GRCm39) missense probably benign 0.00
IGL00990:Bod1l APN 5 41,986,208 (GRCm39) missense probably benign 0.00
IGL01021:Bod1l APN 5 41,995,516 (GRCm39) splice site probably benign
IGL01022:Bod1l APN 5 41,951,652 (GRCm39) missense probably damaging 1.00
IGL01303:Bod1l APN 5 41,974,942 (GRCm39) missense probably benign 0.00
IGL01654:Bod1l APN 5 41,975,519 (GRCm39) missense probably damaging 0.99
IGL01748:Bod1l APN 5 41,974,304 (GRCm39) missense probably benign 0.23
IGL01758:Bod1l APN 5 41,983,953 (GRCm39) splice site probably benign
IGL01783:Bod1l APN 5 41,966,055 (GRCm39) missense probably benign 0.02
IGL01790:Bod1l APN 5 41,989,593 (GRCm39) missense probably benign 0.14
IGL01803:Bod1l APN 5 41,974,732 (GRCm39) missense probably damaging 0.97
IGL01829:Bod1l APN 5 41,977,811 (GRCm39) missense probably benign 0.25
IGL01952:Bod1l APN 5 41,974,297 (GRCm39) missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02110:Bod1l APN 5 41,973,796 (GRCm39) missense probably damaging 0.97
IGL02129:Bod1l APN 5 41,979,193 (GRCm39) missense probably benign 0.36
IGL02572:Bod1l APN 5 41,978,573 (GRCm39) nonsense probably null
IGL02583:Bod1l APN 5 41,973,550 (GRCm39) critical splice donor site probably null
IGL02643:Bod1l APN 5 41,976,148 (GRCm39) missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02728:Bod1l APN 5 41,983,846 (GRCm39) missense probably damaging 1.00
IGL02752:Bod1l APN 5 41,973,806 (GRCm39) missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41,951,688 (GRCm39) missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41,988,927 (GRCm39) missense probably benign 0.16
IGL03372:Bod1l APN 5 41,962,578 (GRCm39) splice site probably benign
capacitance UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
gauss UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
Tesla UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R0102:Bod1l UTSW 5 41,974,612 (GRCm39) missense probably benign 0.36
R0147:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41,979,235 (GRCm39) missense probably damaging 0.96
R0577:Bod1l UTSW 5 41,952,230 (GRCm39) missense probably damaging 1.00
R0587:Bod1l UTSW 5 41,978,980 (GRCm39) missense probably benign 0.16
R0620:Bod1l UTSW 5 41,958,576 (GRCm39) missense probably benign 0.16
R0626:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R0785:Bod1l UTSW 5 41,977,359 (GRCm39) missense probably benign 0.00
R1139:Bod1l UTSW 5 41,988,814 (GRCm39) missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41,978,396 (GRCm39) missense probably benign 0.02
R1418:Bod1l UTSW 5 41,976,814 (GRCm39) missense probably damaging 1.00
R1509:Bod1l UTSW 5 41,976,883 (GRCm39) missense probably damaging 0.99
R1533:Bod1l UTSW 5 41,979,498 (GRCm39) nonsense probably null
R1538:Bod1l UTSW 5 41,973,772 (GRCm39) missense probably benign 0.00
R1591:Bod1l UTSW 5 41,976,563 (GRCm39) missense probably benign 0.06
R1616:Bod1l UTSW 5 41,966,058 (GRCm39) missense probably benign
R1628:Bod1l UTSW 5 41,974,325 (GRCm39) missense probably benign 0.01
R1667:Bod1l UTSW 5 41,974,118 (GRCm39) missense probably benign 0.01
R1869:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41,974,679 (GRCm39) missense probably damaging 1.00
R2060:Bod1l UTSW 5 41,966,085 (GRCm39) missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41,962,499 (GRCm39) missense probably damaging 0.99
R2067:Bod1l UTSW 5 41,974,429 (GRCm39) missense probably benign 0.11
R2073:Bod1l UTSW 5 41,976,532 (GRCm39) missense probably benign 0.19
R2092:Bod1l UTSW 5 41,988,860 (GRCm39) missense probably damaging 1.00
R2105:Bod1l UTSW 5 41,989,622 (GRCm39) missense probably benign 0.00
R2243:Bod1l UTSW 5 41,978,888 (GRCm39) missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41,984,463 (GRCm39) missense probably benign 0.09
R2849:Bod1l UTSW 5 41,995,419 (GRCm39) missense probably damaging 1.00
R2883:Bod1l UTSW 5 41,989,602 (GRCm39) missense probably benign 0.03
R3037:Bod1l UTSW 5 41,979,380 (GRCm39) missense probably damaging 0.99
R3910:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3911:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3962:Bod1l UTSW 5 41,966,064 (GRCm39) missense probably benign 0.07
R4235:Bod1l UTSW 5 41,978,798 (GRCm39) missense probably damaging 1.00
R4308:Bod1l UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41,977,870 (GRCm39) missense probably benign 0.04
R4535:Bod1l UTSW 5 41,989,574 (GRCm39) missense probably benign 0.06
R4631:Bod1l UTSW 5 41,975,078 (GRCm39) missense probably damaging 1.00
R4657:Bod1l UTSW 5 41,975,955 (GRCm39) missense probably benign 0.00
R4782:Bod1l UTSW 5 41,991,006 (GRCm39) missense probably benign 0.06
R4786:Bod1l UTSW 5 41,976,781 (GRCm39) missense probably benign 0.43
R4840:Bod1l UTSW 5 41,975,815 (GRCm39) missense probably damaging 1.00
R4877:Bod1l UTSW 5 41,977,337 (GRCm39) missense probably benign 0.00
R4982:Bod1l UTSW 5 41,977,816 (GRCm39) missense probably benign 0.00
R5152:Bod1l UTSW 5 41,973,886 (GRCm39) missense probably benign 0.04
R5284:Bod1l UTSW 5 41,977,810 (GRCm39) missense probably benign 0.05
R5354:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R5369:Bod1l UTSW 5 41,984,526 (GRCm39) missense probably damaging 1.00
R5486:Bod1l UTSW 5 41,964,524 (GRCm39) missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41,949,276 (GRCm39) missense probably benign 0.06
R5610:Bod1l UTSW 5 41,979,217 (GRCm39) missense probably damaging 1.00
R5655:Bod1l UTSW 5 41,974,387 (GRCm39) missense probably benign 0.06
R5705:Bod1l UTSW 5 41,974,345 (GRCm39) missense probably benign 0.01
R5819:Bod1l UTSW 5 41,989,948 (GRCm39) missense probably benign 0.27
R5890:Bod1l UTSW 5 41,977,921 (GRCm39) missense probably benign 0.43
R5923:Bod1l UTSW 5 41,974,762 (GRCm39) missense probably damaging 1.00
R5991:Bod1l UTSW 5 41,974,206 (GRCm39) nonsense probably null
R6017:Bod1l UTSW 5 41,976,103 (GRCm39) missense probably benign 0.01
R6253:Bod1l UTSW 5 41,983,881 (GRCm39) missense probably damaging 0.96
R6284:Bod1l UTSW 5 41,976,130 (GRCm39) missense probably benign 0.35
R6483:Bod1l UTSW 5 41,978,425 (GRCm39) missense probably benign 0.03
R6485:Bod1l UTSW 5 41,974,459 (GRCm39) missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41,995,411 (GRCm39) missense probably damaging 1.00
R6679:Bod1l UTSW 5 41,974,009 (GRCm39) missense probably damaging 0.97
R6788:Bod1l UTSW 5 41,979,216 (GRCm39) nonsense probably null
R7006:Bod1l UTSW 5 41,989,895 (GRCm39) missense probably damaging 1.00
R7095:Bod1l UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R7111:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7190:Bod1l UTSW 5 41,977,281 (GRCm39) missense probably benign 0.14
R7311:Bod1l UTSW 5 41,951,676 (GRCm39) missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41,978,867 (GRCm39) missense probably damaging 1.00
R7341:Bod1l UTSW 5 41,946,200 (GRCm39) missense probably benign 0.00
R7396:Bod1l UTSW 5 41,988,889 (GRCm39) missense probably damaging 1.00
R7431:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7442:Bod1l UTSW 5 41,964,522 (GRCm39) missense probably damaging 0.96
R7539:Bod1l UTSW 5 41,975,203 (GRCm39) missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41,991,133 (GRCm39) missense probably damaging 1.00
R7748:Bod1l UTSW 5 41,989,683 (GRCm39) missense probably damaging 0.97
R7767:Bod1l UTSW 5 41,974,099 (GRCm39) missense probably benign 0.01
R7773:Bod1l UTSW 5 41,990,055 (GRCm39) missense probably benign 0.14
R7782:Bod1l UTSW 5 41,975,286 (GRCm39) missense probably benign 0.01
R7860:Bod1l UTSW 5 41,976,608 (GRCm39) missense probably damaging 1.00
R7975:Bod1l UTSW 5 41,973,620 (GRCm39) missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R7987:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R8104:Bod1l UTSW 5 41,991,075 (GRCm39) nonsense probably null
R8217:Bod1l UTSW 5 41,988,850 (GRCm39) missense probably damaging 1.00
R8307:Bod1l UTSW 5 41,978,498 (GRCm39) missense probably damaging 1.00
R8469:Bod1l UTSW 5 41,978,834 (GRCm39) missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41,976,398 (GRCm39) nonsense probably null
R8934:Bod1l UTSW 5 41,976,944 (GRCm39) missense probably benign 0.11
R8984:Bod1l UTSW 5 41,946,215 (GRCm39) missense probably damaging 1.00
R8989:Bod1l UTSW 5 41,979,025 (GRCm39) missense probably benign 0.00
R8993:Bod1l UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
R9128:Bod1l UTSW 5 41,946,266 (GRCm39) missense probably benign 0.22
R9129:Bod1l UTSW 5 41,976,220 (GRCm39) missense probably damaging 0.99
R9198:Bod1l UTSW 5 41,957,129 (GRCm39) missense probably benign 0.08
R9254:Bod1l UTSW 5 41,979,223 (GRCm39) missense probably damaging 1.00
R9445:Bod1l UTSW 5 41,974,619 (GRCm39) missense probably benign 0.04
R9457:Bod1l UTSW 5 41,979,310 (GRCm39) missense probably damaging 0.99
R9470:Bod1l UTSW 5 41,974,439 (GRCm39) missense probably damaging 0.99
R9536:Bod1l UTSW 5 41,974,305 (GRCm39) missense probably benign 0.01
R9654:Bod1l UTSW 5 41,975,707 (GRCm39) missense probably benign 0.02
R9734:Bod1l UTSW 5 41,962,573 (GRCm39) missense possibly damaging 0.91
R9771:Bod1l UTSW 5 41,949,206 (GRCm39) missense probably damaging 0.96
X0027:Bod1l UTSW 5 41,990,012 (GRCm39) missense probably benign 0.20
X0058:Bod1l UTSW 5 41,981,361 (GRCm39) missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41,966,107 (GRCm39) missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41,978,489 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACATGTCACAGCTGCTGC -3'
(R):5'- GTCTCAGACGGGCACAGAAG -3'

Sequencing Primer
(F):5'- CTGGTTTTGAATCTACCATGGAAG -3'
(R):5'- TGGTAAAGAAGTTGACAGCAGTC -3'
Posted On 2019-11-12