Mutagenetix > Incidental Mutation

Incidental Mutation 'R7679:Bod1l'

592628

Institutional Source

Beutler Lab

Gene Symbol

Bod1l

Ensembl Gene

ENSMUSG00000061755

Gene Name

biorientation of chromosomes in cell division 1-like

Synonyms

A230054D04Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R7679 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

41787538-41844315 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TTCAGGGATC to TTC at 41820643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000058618 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000050556

SMART Domains

Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	1.8e-28	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	3.21e-1	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202908

SMART Domains

Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755

Domain	Start	End	E-Value	Type
low complexity region	5	47	N/A	INTRINSIC
Pfam:COMPASS-Shg1	54	150	2.9e-24	PFAM
low complexity region	328	343	N/A	INTRINSIC
low complexity region	415	435	N/A	INTRINSIC
low complexity region	475	484	N/A	INTRINSIC
coiled coil region	495	520	N/A	INTRINSIC
coiled coil region	553	580	N/A	INTRINSIC
low complexity region	820	840	N/A	INTRINSIC
low complexity region	895	916	N/A	INTRINSIC
low complexity region	996	1005	N/A	INTRINSIC
low complexity region	1023	1041	N/A	INTRINSIC
low complexity region	1272	1286	N/A	INTRINSIC
low complexity region	1791	1809	N/A	INTRINSIC
low complexity region	2695	2701	N/A	INTRINSIC
low complexity region	2711	2729	N/A	INTRINSIC
AT_hook	2807	2819	1.9e-3	SMART
coiled coil region	2908	2929	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	A	C	14: 78,514,816	Y206D		Het
Atm	A	T	9: 53,442,497	I2906N	probably damaging	Het
B4galnt4	T	C	7: 141,067,765	V422A	probably benign	Het
Ccar2	G	A	14: 70,139,235	Q887*	probably null	Het
Cdh13	A	G	8: 119,236,919	I413V	probably benign	Het
Cfap54	A	G	10: 92,967,512	V1556A	probably benign	Het
Chchd7	A	T	4: 3,941,297	N14Y	probably damaging	Het
Col24a1	C	A	3: 145,399,355	T824N	possibly damaging	Het
Col6a3	A	T	1: 90,811,751	Y859N	possibly damaging	Het
Dnaaf5	C	T	5: 139,150,637	P131S	unknown	Het
Erh	T	C	12: 80,637,571	N44S	probably benign	Het
Esm1	T	A	13: 113,210,112	D90E	probably damaging	Het
Fbxo44	A	G	4: 148,153,632	F213L	probably benign	Het
Flnc	A	G	6: 29,456,790	T2262A	probably benign	Het
Fmo9	T	C	1: 166,667,489	Q281R	probably benign	Het
Gdpgp1	G	T	7: 80,238,576	E118D	probably benign	Het
Gnas	A	T	2: 174,284,831	Q53L	probably damaging	Het
Gpr142	G	A	11: 114,806,707	V360M	possibly damaging	Het
Grn	A	G	11: 102,433,069	D46G	probably benign	Het
H2-T10	A	G	17: 36,119,324	F242L	not run	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Hoxa9	A	G	6: 52,224,308	I251T	probably damaging	Het
Inpp5f	C	T	7: 128,694,523	T866I	possibly damaging	Het
Itgb1	T	A	8: 128,720,448	N481K	probably damaging	Het
Leng9	C	A	7: 4,149,660	D6Y	probably benign	Het
Lox	A	C	18: 52,525,106	F332V	possibly damaging	Het
Lrp1	G	T	10: 127,588,428	Y796*	probably null	Het
Lrrc32	G	A	7: 98,499,687	G558D	possibly damaging	Het
Lrrk2	A	G	15: 91,726,186	E707G	possibly damaging	Het
Matn4	A	G	2: 164,389,658	*625R	probably null	Het
Mcur1	T	A	13: 43,544,483	K314*	probably null	Het
Med1	G	C	11: 98,156,061	P1303R	unknown	Het
Mgam	T	C	6: 40,643,046	L23P	probably damaging	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Nfatc1	T	C	18: 80,607,990	I936V	probably benign	Het
Nol11	T	C	11: 107,173,316	S557G	probably benign	Het
Palb2	A	G	7: 122,128,014	I211T	probably benign	Het
Pard3	T	C	8: 127,371,846	V456A	probably benign	Het
Pax2	G	A	19: 44,760,937	V40M	probably damaging	Het
Pik3cb	T	C	9: 99,088,607	K344E	probably benign	Het
Pik3r3	T	A	4: 116,256,195	M45K	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pot1a	A	G	6: 25,771,634	V196A	probably benign	Het
Ppp1r32	T	C	19: 10,482,254	T30A	probably damaging	Het
Prkdc	T	A	16: 15,831,319	I3719N	probably damaging	Het
Psg16	G	A	7: 17,093,760	G123S	probably damaging	Het
Psme4	A	G	11: 30,878,425	D1815G	probably damaging	Het
Rpe65	C	T	3: 159,604,393	T101I	probably damaging	Het
Rpp25l	A	C	4: 41,712,326	C150G	unknown	Het
Serpina1b	A	T	12: 103,730,515	W212R	probably damaging	Het
Slc9a3	G	A	13: 74,160,276	R466H	possibly damaging	Het
Sned1	T	C	1: 93,236,038	L17P	unknown	Het
Speg	C	T	1: 75,406,315	T1056I	probably damaging	Het
Tada1	T	C	1: 166,391,971	F281L	probably benign	Het
Tbcd	G	A	11: 121,603,708	V1032I	probably benign	Het
Tlr3	A	T	8: 45,399,051	S270T	probably benign	Het
Txndc15	G	T	13: 55,725,808	R327L	probably damaging	Het
Zfp169	G	C	13: 48,498,383	L66V	probably damaging	Het
Zfp442	G	T	2: 150,410,997	Y45*	probably null	Het
Zzef1	A	G	11: 72,893,278	D2003G	probably benign	Het

Other mutations in Bod1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Bod1l	APN	5	41816823	missense	probably benign	0.00
IGL00990:Bod1l	APN	5	41828865	missense	probably benign	0.00
IGL01021:Bod1l	APN	5	41838173	splice site	probably benign
IGL01022:Bod1l	APN	5	41794309	missense	probably damaging	1.00
IGL01303:Bod1l	APN	5	41817599	missense	probably benign	0.00
IGL01654:Bod1l	APN	5	41818176	missense	probably damaging	0.99
IGL01748:Bod1l	APN	5	41816961	missense	probably benign	0.23
IGL01758:Bod1l	APN	5	41826610	splice site	probably benign
IGL01783:Bod1l	APN	5	41808712	missense	probably benign	0.02
IGL01790:Bod1l	APN	5	41832250	missense	probably benign	0.14
IGL01803:Bod1l	APN	5	41817389	missense	probably damaging	0.97
IGL01829:Bod1l	APN	5	41820468	missense	probably benign	0.25
IGL01952:Bod1l	APN	5	41816954	missense	possibly damaging	0.70
IGL02005:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02110:Bod1l	APN	5	41816453	missense	probably damaging	0.97
IGL02129:Bod1l	APN	5	41821850	missense	probably benign	0.36
IGL02572:Bod1l	APN	5	41821230	nonsense	probably null
IGL02583:Bod1l	APN	5	41816207	critical splice donor site	probably null
IGL02643:Bod1l	APN	5	41818805	missense	possibly damaging	0.65
IGL02714:Bod1l	APN	5	41816339	missense	probably benign	0.01
IGL02728:Bod1l	APN	5	41826503	missense	probably damaging	1.00
IGL02752:Bod1l	APN	5	41816463	missense	possibly damaging	0.58
IGL02822:Bod1l	APN	5	41794345	missense	possibly damaging	0.94
IGL03032:Bod1l	APN	5	41831584	missense	probably benign	0.16
IGL03372:Bod1l	APN	5	41805235	splice site	probably benign
capacitance	UTSW	5	41791813	missense	possibly damaging	0.91
gauss	UTSW	5	41816867	missense	probably benign	0.01
Tesla	UTSW	5	41795068	critical splice donor site	probably null
R0102:Bod1l	UTSW	5	41817269	missense	probably benign	0.36
R0147:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0148:Bod1l	UTSW	5	41818697	missense	possibly damaging	0.48
R0490:Bod1l	UTSW	5	41821892	missense	probably damaging	0.96
R0577:Bod1l	UTSW	5	41794887	missense	probably damaging	1.00
R0587:Bod1l	UTSW	5	41821637	missense	probably benign	0.16
R0620:Bod1l	UTSW	5	41801233	missense	probably benign	0.16
R0626:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R0785:Bod1l	UTSW	5	41820016	missense	probably benign	0.00
R1139:Bod1l	UTSW	5	41831471	missense	possibly damaging	0.64
R1165:Bod1l	UTSW	5	41821053	missense	probably benign	0.02
R1418:Bod1l	UTSW	5	41819471	missense	probably damaging	1.00
R1509:Bod1l	UTSW	5	41819540	missense	probably damaging	0.99
R1533:Bod1l	UTSW	5	41822155	nonsense	probably null
R1538:Bod1l	UTSW	5	41816429	missense	probably benign	0.00
R1591:Bod1l	UTSW	5	41819220	missense	probably benign	0.06
R1616:Bod1l	UTSW	5	41808715	missense	probably benign
R1628:Bod1l	UTSW	5	41816982	missense	probably benign	0.01
R1667:Bod1l	UTSW	5	41816775	missense	probably benign	0.01
R1869:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1870:Bod1l	UTSW	5	41833675	missense	possibly damaging	0.93
R1993:Bod1l	UTSW	5	41817336	missense	probably damaging	1.00
R2060:Bod1l	UTSW	5	41808742	missense	possibly damaging	0.58
R2066:Bod1l	UTSW	5	41805156	missense	probably damaging	0.99
R2067:Bod1l	UTSW	5	41817086	missense	probably benign	0.11
R2073:Bod1l	UTSW	5	41819189	missense	probably benign	0.19
R2092:Bod1l	UTSW	5	41831517	missense	probably damaging	1.00
R2105:Bod1l	UTSW	5	41832279	missense	probably benign	0.00
R2243:Bod1l	UTSW	5	41821545	missense	possibly damaging	0.58
R2322:Bod1l	UTSW	5	41827120	missense	probably benign	0.09
R2849:Bod1l	UTSW	5	41838076	missense	probably damaging	1.00
R2883:Bod1l	UTSW	5	41832259	missense	probably benign	0.03
R3037:Bod1l	UTSW	5	41822037	missense	probably damaging	0.99
R3910:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3911:Bod1l	UTSW	5	41817098	missense	probably damaging	0.99
R3962:Bod1l	UTSW	5	41808721	missense	probably benign	0.07
R4235:Bod1l	UTSW	5	41821455	missense	probably damaging	1.00
R4308:Bod1l	UTSW	5	41791813	missense	possibly damaging	0.91
R4414:Bod1l	UTSW	5	41820527	missense	probably benign	0.04
R4535:Bod1l	UTSW	5	41832231	missense	probably benign	0.06
R4631:Bod1l	UTSW	5	41817735	missense	probably damaging	1.00
R4657:Bod1l	UTSW	5	41818612	missense	probably benign	0.00
R4782:Bod1l	UTSW	5	41833663	missense	probably benign	0.06
R4786:Bod1l	UTSW	5	41819438	missense	probably benign	0.43
R4840:Bod1l	UTSW	5	41818472	missense	probably damaging	1.00
R4877:Bod1l	UTSW	5	41819994	missense	probably benign	0.00
R4982:Bod1l	UTSW	5	41820473	missense	probably benign	0.00
R5152:Bod1l	UTSW	5	41816543	missense	probably benign	0.04
R5284:Bod1l	UTSW	5	41820467	missense	probably benign	0.05
R5354:Bod1l	UTSW	5	41831537	missense	probably damaging	1.00
R5369:Bod1l	UTSW	5	41827183	missense	probably damaging	1.00
R5486:Bod1l	UTSW	5	41807181	missense	possibly damaging	0.56
R5541:Bod1l	UTSW	5	41791933	missense	probably benign	0.06
R5610:Bod1l	UTSW	5	41821874	missense	probably damaging	1.00
R5655:Bod1l	UTSW	5	41817044	missense	probably benign	0.06
R5705:Bod1l	UTSW	5	41817002	missense	probably benign	0.01
R5819:Bod1l	UTSW	5	41832605	missense	probably benign	0.27
R5890:Bod1l	UTSW	5	41820578	missense	probably benign	0.43
R5923:Bod1l	UTSW	5	41817419	missense	probably damaging	1.00
R5991:Bod1l	UTSW	5	41816863	nonsense	probably null
R6017:Bod1l	UTSW	5	41818760	missense	probably benign	0.01
R6253:Bod1l	UTSW	5	41826538	missense	probably damaging	0.96
R6284:Bod1l	UTSW	5	41818787	missense	probably benign	0.35
R6483:Bod1l	UTSW	5	41821082	missense	probably benign	0.03
R6485:Bod1l	UTSW	5	41817116	missense	possibly damaging	0.93
R6575:Bod1l	UTSW	5	41838068	missense	probably damaging	1.00
R6679:Bod1l	UTSW	5	41816666	missense	probably damaging	0.97
R6788:Bod1l	UTSW	5	41821873	nonsense	probably null
R7006:Bod1l	UTSW	5	41832552	missense	probably damaging	1.00
R7095:Bod1l	UTSW	5	41795068	critical splice donor site	probably null
R7111:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7190:Bod1l	UTSW	5	41819938	missense	probably benign	0.14
R7311:Bod1l	UTSW	5	41794333	missense	possibly damaging	0.57
R7336:Bod1l	UTSW	5	41821524	missense	probably damaging	1.00
R7341:Bod1l	UTSW	5	41788857	missense	probably benign	0.00
R7396:Bod1l	UTSW	5	41831546	missense	probably damaging	1.00
R7431:Bod1l	UTSW	5	41813120	critical splice donor site	probably null
R7442:Bod1l	UTSW	5	41807179	missense	probably damaging	0.96
R7539:Bod1l	UTSW	5	41817860	missense	possibly damaging	0.65
R7583:Bod1l	UTSW	5	41833790	missense	probably damaging	1.00
R7748:Bod1l	UTSW	5	41832340	missense	probably damaging	0.97
R7767:Bod1l	UTSW	5	41816756	missense	probably benign	0.01
R7773:Bod1l	UTSW	5	41832712	missense	probably benign	0.14
R7782:Bod1l	UTSW	5	41817943	missense	probably benign	0.01
R7860:Bod1l	UTSW	5	41819265	missense	probably damaging	1.00
R7975:Bod1l	UTSW	5	41816277	missense	possibly damaging	0.90
R7977:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R7987:Bod1l	UTSW	5	41795070	missense	probably damaging	1.00
R8104:Bod1l	UTSW	5	41833732	nonsense	probably null
R8217:Bod1l	UTSW	5	41831507	missense	probably damaging	1.00
R8307:Bod1l	UTSW	5	41821155	missense	probably damaging	1.00
R8469:Bod1l	UTSW	5	41821491	missense	possibly damaging	0.86
R8506:Bod1l	UTSW	5	41819055	nonsense	probably null
R8934:Bod1l	UTSW	5	41819601	missense	probably benign	0.11
R8984:Bod1l	UTSW	5	41788872	missense	probably damaging	1.00
R8989:Bod1l	UTSW	5	41821682	missense	probably benign	0.00
R8993:Bod1l	UTSW	5	41816867	missense	probably benign	0.01
R9128:Bod1l	UTSW	5	41788923	missense	probably benign	0.22
R9129:Bod1l	UTSW	5	41818877	missense	probably damaging	0.99
R9198:Bod1l	UTSW	5	41799786	missense	probably benign	0.08
R9254:Bod1l	UTSW	5	41821880	missense	probably damaging	1.00
R9445:Bod1l	UTSW	5	41817276	missense	probably benign	0.04
R9457:Bod1l	UTSW	5	41821967	missense	probably damaging	0.99
R9470:Bod1l	UTSW	5	41817096	missense	probably damaging	0.99
R9536:Bod1l	UTSW	5	41816962	missense	probably benign	0.01
R9654:Bod1l	UTSW	5	41818364	missense	probably benign	0.02
R9734:Bod1l	UTSW	5	41805230	missense	possibly damaging	0.91
R9771:Bod1l	UTSW	5	41791863	missense	probably damaging	0.96
X0027:Bod1l	UTSW	5	41832669	missense	probably benign	0.20
X0058:Bod1l	UTSW	5	41824018	missense	probably damaging	1.00
Z1088:Bod1l	UTSW	5	41808764	missense	possibly damaging	0.95
Z1088:Bod1l	UTSW	5	41821146	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACATGTCACAGCTGCTGC -3'
(R):5'- GTCTCAGACGGGCACAGAAG -3'

Sequencing Primer
(F):5'- CTGGTTTTGAATCTACCATGGAAG -3'
(R):5'- TGGTAAAGAAGTTGACAGCAGTC -3'

Posted On

2019-11-12