Mutagenetix > Incidental Mutation

Incidental Mutation 'R0239:Greb1l'

59264

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

038477-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0239 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 10458567 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.9%
20x: 96.2%

Validation Efficiency

98% (81/83)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1d	C	A	2: 131,546,214	V474F	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Ash1l	A	G	3: 89,067,222	D2618G	possibly damaging	Het
Atp6v1c2	C	A	12: 17,294,675		probably null	Het
Cacna1d	A	G	14: 30,123,496	V572A	probably benign	Het
Camta1	A	G	4: 151,143,730	W882R	probably damaging	Het
Cd72	A	G	4: 43,453,163	V91A	probably benign	Het
Cdh12	T	C	15: 21,586,407	W771R	probably damaging	Het
Cdx2	G	T	5: 147,303,287	T193K	probably damaging	Het
Cfap70	A	C	14: 20,448,605	S5A	probably benign	Het
Chmp7	A	G	14: 69,720,997	V241A	probably damaging	Het
Col4a1	C	T	8: 11,218,780		probably benign	Het
D3Ertd751e	A	G	3: 41,753,878	Y150C	probably damaging	Het
Depdc5	T	C	5: 32,943,240	S832P	probably damaging	Het
Dnhd1	A	G	7: 105,721,531	S4673G	probably benign	Het
Dock4	G	T	12: 40,737,540	S818I	probably damaging	Het
Dysf	C	T	6: 84,064,479	Q156*	probably null	Het
Espnl	T	C	1: 91,322,287	V52A	probably damaging	Het
Flcn	T	C	11: 59,801,076	N249S	probably benign	Het
Gemin6	C	A	17: 80,225,710	A24D	probably damaging	Het
Gm5773	A	G	3: 93,774,032	H337R	probably benign	Het
Gm9733	A	G	3: 15,296,601	L163P	probably damaging	Het
Hal	T	C	10: 93,503,482	S478P	possibly damaging	Het
Hectd1	T	A	12: 51,769,318	M1324L	possibly damaging	Het
Hyal5	T	A	6: 24,876,344	L72Q	probably damaging	Het
Ift140	C	A	17: 25,045,523	C557*	probably null	Het
Ikbkap	C	A	4: 56,784,596	V466L	probably benign	Het
Il4ra	T	C	7: 125,575,199		probably benign	Het
Ipo9	A	G	1: 135,404,336		probably benign	Het
Kbtbd3	G	T	9: 4,330,144	V173L	possibly damaging	Het
Kif14	A	G	1: 136,527,393	E1551G	probably damaging	Het
Klc1	A	G	12: 111,785,324		probably benign	Het
Krt17	G	A	11: 100,260,878	R30*	probably null	Het
Lamb3	A	T	1: 193,321,053	D100V	probably damaging	Het
Lrmp	G	A	6: 145,171,978		probably benign	Het
Map2	A	G	1: 66,416,106	D1385G	probably damaging	Het
Mettl25	C	T	10: 105,826,525	V195I	probably damaging	Het
Mfsd7a	G	T	5: 108,444,016		probably benign	Het
Micu2	G	A	14: 57,917,378		probably benign	Het
Mrrf	T	C	2: 36,177,281		probably benign	Het
Myh8	A	G	11: 67,301,692	T1466A	probably benign	Het
Myo3b	T	A	2: 70,105,425	C61S	probably benign	Het
Nacc2	T	G	2: 26,062,261	N361T	probably damaging	Het
Nf1	A	T	11: 79,418,574	K438M	possibly damaging	Het
Nipal4	A	G	11: 46,150,441	V309A	possibly damaging	Het
Nomo1	T	C	7: 46,079,594		probably null	Het
Nubp2	T	C	17: 24,884,471	E144G	probably damaging	Het
Nwd2	A	T	5: 63,800,124	I266F	probably benign	Het
Olfr1126	T	C	2: 87,458,037	F291L	probably benign	Het
Olfr593	G	A	7: 103,212,726	V289M	possibly damaging	Het
Olfr694	A	G	7: 106,689,255	Y159H	probably benign	Het
Orc1	T	C	4: 108,595,646		probably null	Het
Otogl	T	A	10: 107,806,696	N1291I	probably damaging	Het
Pah	C	T	10: 87,567,281	P173S	possibly damaging	Het
Pga5	A	G	19: 10,669,453	Y305H	probably damaging	Het
Plekha4	A	G	7: 45,532,358	H62R	probably damaging	Het
Plxnd1	G	T	6: 115,968,793	D906E	probably benign	Het
Ppfia4	T	C	1: 134,329,189	E98G	possibly damaging	Het
Ptk2	A	T	15: 73,343,283		probably null	Het
Pzp	C	T	6: 128,489,156		probably benign	Het
Raet1c	C	A	10: 22,180,862	H112Q	possibly damaging	Het
Scai	T	A	2: 39,075,042	I597F	probably benign	Het
Scgb1b2	T	A	7: 31,291,730		probably benign	Het
Sec31b	G	A	19: 44,525,469		probably benign	Het
Slc35c2	C	T	2: 165,280,837	G176S	probably damaging	Het
Slc35f4	A	T	14: 49,304,256	I347N	possibly damaging	Het
Slc52a3	T	C	2: 152,008,156	*461Q	probably null	Het
Slc6a1	G	A	6: 114,302,800	V142I	probably benign	Het
Tbc1d31	C	A	15: 57,940,753	T388N	probably benign	Het
Tmem131	T	C	1: 36,828,050		probably benign	Het
Tmem63c	T	C	12: 87,075,639	W404R	probably damaging	Het
Tmem79	A	G	3: 88,333,321	S107P	probably benign	Het
Trip11	C	T	12: 101,884,728	E741K	probably damaging	Het
Trpm5	G	T	7: 143,082,958	T414N	probably damaging	Het
Tsnaxip1	T	A	8: 105,844,488	I660N	possibly damaging	Het
Ube2q2	T	C	9: 55,163,007	S78P	probably damaging	Het
Vac14	A	T	8: 110,635,375		probably null	Het
Vps51	G	T	19: 6,071,437	S185*	probably null	Het
Zfp11	C	T	5: 129,658,238	G53E	possibly damaging	Het
Zfp532	A	T	18: 65,682,985	I810F	possibly damaging	Het
Zfp599	C	T	9: 22,249,759	C370Y	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTACTTGGACCCAGACCAGCATC -3'
(R):5'- ACCATCTGTCGTGCAAGATCCTTC -3'

Sequencing Primer
(F):5'- GCAGGTAAGTTTCTCAATTACAGGC -3'
(R):5'- TGCAAGATCCTTCTGGGGC -3'

Posted On

2013-07-11