Incidental Mutation 'R7679:Zfp169'
ID 592662
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7679 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 48487647-48513451 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 48498383 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 66 (L66V)
Ref Sequence ENSEMBL: ENSMUSP00000134793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: L66V
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167682
AA Change: L66V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176176
AA Change: L66V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176949
AA Change: L66V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000176996
AA Change: L66V
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: L66V
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,514,816 Y206D Het
Atm A T 9: 53,442,497 I2906N probably damaging Het
B4galnt4 T C 7: 141,067,765 V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,820,643 probably null Het
Ccar2 G A 14: 70,139,235 Q887* probably null Het
Cdh13 A G 8: 119,236,919 I413V probably benign Het
Cfap54 A G 10: 92,967,512 V1556A probably benign Het
Chchd7 A T 4: 3,941,297 N14Y probably damaging Het
Col24a1 C A 3: 145,399,355 T824N possibly damaging Het
Col6a3 A T 1: 90,811,751 Y859N possibly damaging Het
Dnaaf5 C T 5: 139,150,637 P131S unknown Het
Erh T C 12: 80,637,571 N44S probably benign Het
Esm1 T A 13: 113,210,112 D90E probably damaging Het
Fbxo44 A G 4: 148,153,632 F213L probably benign Het
Flnc A G 6: 29,456,790 T2262A probably benign Het
Fmo9 T C 1: 166,667,489 Q281R probably benign Het
Gdpgp1 G T 7: 80,238,576 E118D probably benign Het
Gnas A T 2: 174,284,831 Q53L probably damaging Het
Gpr142 G A 11: 114,806,707 V360M possibly damaging Het
Grn A G 11: 102,433,069 D46G probably benign Het
H2-T10 A G 17: 36,119,324 F242L not run Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Hoxa9 A G 6: 52,224,308 I251T probably damaging Het
Inpp5f C T 7: 128,694,523 T866I possibly damaging Het
Itgb1 T A 8: 128,720,448 N481K probably damaging Het
Leng9 C A 7: 4,149,660 D6Y probably benign Het
Lox A C 18: 52,525,106 F332V possibly damaging Het
Lrp1 G T 10: 127,588,428 Y796* probably null Het
Lrrc32 G A 7: 98,499,687 G558D possibly damaging Het
Lrrk2 A G 15: 91,726,186 E707G possibly damaging Het
Matn4 A G 2: 164,389,658 *625R probably null Het
Mcur1 T A 13: 43,544,483 K314* probably null Het
Med1 G C 11: 98,156,061 P1303R unknown Het
Mgam T C 6: 40,643,046 L23P probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nfatc1 T C 18: 80,607,990 I936V probably benign Het
Nol11 T C 11: 107,173,316 S557G probably benign Het
Palb2 A G 7: 122,128,014 I211T probably benign Het
Pard3 T C 8: 127,371,846 V456A probably benign Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pik3cb T C 9: 99,088,607 K344E probably benign Het
Pik3r3 T A 4: 116,256,195 M45K probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pot1a A G 6: 25,771,634 V196A probably benign Het
Ppp1r32 T C 19: 10,482,254 T30A probably damaging Het
Prkdc T A 16: 15,831,319 I3719N probably damaging Het
Psg16 G A 7: 17,093,760 G123S probably damaging Het
Psme4 A G 11: 30,878,425 D1815G probably damaging Het
Rpe65 C T 3: 159,604,393 T101I probably damaging Het
Rpp25l A C 4: 41,712,326 C150G unknown Het
Serpina1b A T 12: 103,730,515 W212R probably damaging Het
Slc9a3 G A 13: 74,160,276 R466H possibly damaging Het
Sned1 T C 1: 93,236,038 L17P unknown Het
Speg C T 1: 75,406,315 T1056I probably damaging Het
Tada1 T C 1: 166,391,971 F281L probably benign Het
Tbcd G A 11: 121,603,708 V1032I probably benign Het
Tlr3 A T 8: 45,399,051 S270T probably benign Het
Txndc15 G T 13: 55,725,808 R327L probably damaging Het
Zfp442 G T 2: 150,410,997 Y45* probably null Het
Zzef1 A G 11: 72,893,278 D2003G probably benign Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48490481 missense unknown
BB020:Zfp169 UTSW 13 48490481 missense unknown
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48489996 missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7933:Zfp169 UTSW 13 48490481 missense unknown
R8298:Zfp169 UTSW 13 48498377 nonsense probably null
R8322:Zfp169 UTSW 13 48491099 missense unknown
R9047:Zfp169 UTSW 13 48498816 missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48491081 missense unknown
R9126:Zfp169 UTSW 13 48491081 missense unknown
R9131:Zfp169 UTSW 13 48491081 missense unknown
R9132:Zfp169 UTSW 13 48491081 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGGCCTACAGAAGAGCTCC -3'
(R):5'- ATGTATTTCTAGGGGCGATTGACC -3'

Sequencing Primer
(F):5'- CCCTTAGCATGTCAGAGTAGGTC -3'
(R):5'- GATTGACCCTGCTTTTGACCTAGG -3'
Posted On 2019-11-12