Incidental Mutation 'R7679:Zfp169'
ID 592662
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms 4930429A13Rik, 1700025J14Rik
MMRRC Submission 045707-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7679 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 48641123-48666927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 48651859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 66 (L66V)
Ref Sequence ENSEMBL: ENSMUSP00000134793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect unknown
Transcript: ENSMUST00000110110
AA Change: L66V
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167682
AA Change: L66V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176176
AA Change: L66V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176949
AA Change: L66V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000176996
AA Change: L66V
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177530
AA Change: L66V
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: L66V

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,752,256 (GRCm39) Y206D Het
Atm A T 9: 53,353,797 (GRCm39) I2906N probably damaging Het
B4galnt4 T C 7: 140,647,678 (GRCm39) V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,977,986 (GRCm39) probably null Het
Ccar2 G A 14: 70,376,684 (GRCm39) Q887* probably null Het
Cdh13 A G 8: 119,963,658 (GRCm39) I413V probably benign Het
Cfap54 A G 10: 92,803,374 (GRCm39) V1556A probably benign Het
Chchd7 A T 4: 3,941,297 (GRCm39) N14Y probably damaging Het
Col24a1 C A 3: 145,105,110 (GRCm39) T824N possibly damaging Het
Col6a3 A T 1: 90,739,473 (GRCm39) Y859N possibly damaging Het
Dnaaf5 C T 5: 139,136,392 (GRCm39) P131S unknown Het
Erh T C 12: 80,684,345 (GRCm39) N44S probably benign Het
Esm1 T A 13: 113,346,646 (GRCm39) D90E probably damaging Het
Fbxo44 A G 4: 148,238,089 (GRCm39) F213L probably benign Het
Flnc A G 6: 29,456,789 (GRCm39) T2262A probably benign Het
Fmo9 T C 1: 166,495,058 (GRCm39) Q281R probably benign Het
Gdpgp1 G T 7: 79,888,324 (GRCm39) E118D probably benign Het
Gnas A T 2: 174,126,624 (GRCm39) Q53L probably damaging Het
Gpr142 G A 11: 114,697,533 (GRCm39) V360M possibly damaging Het
Grn A G 11: 102,323,895 (GRCm39) D46G probably benign Het
H2-T10 A G 17: 36,430,216 (GRCm39) F242L not run Het
Hgsnat T C 8: 26,444,665 (GRCm39) T428A probably damaging Het
Hoxa9 A G 6: 52,201,288 (GRCm39) I251T probably damaging Het
Inpp5f C T 7: 128,296,247 (GRCm39) T866I possibly damaging Het
Itgb1 T A 8: 129,446,929 (GRCm39) N481K probably damaging Het
Leng9 C A 7: 4,152,659 (GRCm39) D6Y probably benign Het
Lox A C 18: 52,658,178 (GRCm39) F332V possibly damaging Het
Lrp1 G T 10: 127,424,297 (GRCm39) Y796* probably null Het
Lrrc32 G A 7: 98,148,894 (GRCm39) G558D possibly damaging Het
Lrrk2 A G 15: 91,610,389 (GRCm39) E707G possibly damaging Het
Matn4 A G 2: 164,231,578 (GRCm39) *625R probably null Het
Mcur1 T A 13: 43,697,959 (GRCm39) K314* probably null Het
Med1 G C 11: 98,046,887 (GRCm39) P1303R unknown Het
Mgam T C 6: 40,619,980 (GRCm39) L23P probably damaging Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Nfatc1 T C 18: 80,651,205 (GRCm39) I936V probably benign Het
Nol11 T C 11: 107,064,142 (GRCm39) S557G probably benign Het
Palb2 A G 7: 121,727,237 (GRCm39) I211T probably benign Het
Pard3 T C 8: 128,098,327 (GRCm39) V456A probably benign Het
Pax2 G A 19: 44,749,376 (GRCm39) V40M probably damaging Het
Pik3cb T C 9: 98,970,660 (GRCm39) K344E probably benign Het
Pik3r3 T A 4: 116,113,392 (GRCm39) M45K probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Pot1a A G 6: 25,771,633 (GRCm39) V196A probably benign Het
Prkdc T A 16: 15,649,183 (GRCm39) I3719N probably damaging Het
Psg16 G A 7: 16,827,685 (GRCm39) G123S probably damaging Het
Psme4 A G 11: 30,828,425 (GRCm39) D1815G probably damaging Het
Rpe65 C T 3: 159,310,030 (GRCm39) T101I probably damaging Het
Rpp25l A C 4: 41,712,326 (GRCm39) C150G unknown Het
Saxo4 T C 19: 10,459,618 (GRCm39) T30A probably damaging Het
Serpina1b A T 12: 103,696,774 (GRCm39) W212R probably damaging Het
Slc9a3 G A 13: 74,308,395 (GRCm39) R466H possibly damaging Het
Sned1 T C 1: 93,163,760 (GRCm39) L17P unknown Het
Speg C T 1: 75,382,959 (GRCm39) T1056I probably damaging Het
Tada1 T C 1: 166,219,540 (GRCm39) F281L probably benign Het
Tbcd G A 11: 121,494,534 (GRCm39) V1032I probably benign Het
Tlr3 A T 8: 45,852,088 (GRCm39) S270T probably benign Het
Txndc15 G T 13: 55,873,621 (GRCm39) R327L probably damaging Het
Zfp442 G T 2: 150,252,917 (GRCm39) Y45* probably null Het
Zzef1 A G 11: 72,784,104 (GRCm39) D2003G probably benign Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48,644,239 (GRCm39) unclassified probably benign
IGL03329:Zfp169 APN 13 48,644,270 (GRCm39) unclassified probably benign
IGL03382:Zfp169 APN 13 48,644,639 (GRCm39) unclassified probably benign
IGL03394:Zfp169 APN 13 48,643,400 (GRCm39) missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
BB020:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R0571:Zfp169 UTSW 13 48,643,166 (GRCm39) missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48,652,330 (GRCm39) missense probably benign 0.35
R1784:Zfp169 UTSW 13 48,643,295 (GRCm39) missense possibly damaging 0.61
R3108:Zfp169 UTSW 13 48,643,472 (GRCm39) missense possibly damaging 0.86
R3689:Zfp169 UTSW 13 48,660,377 (GRCm39) splice site probably benign
R4444:Zfp169 UTSW 13 48,643,813 (GRCm39) missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48,644,339 (GRCm39) unclassified probably benign
R4719:Zfp169 UTSW 13 48,643,634 (GRCm39) missense probably benign 0.06
R4745:Zfp169 UTSW 13 48,643,708 (GRCm39) missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48,644,516 (GRCm39) unclassified probably benign
R6053:Zfp169 UTSW 13 48,652,334 (GRCm39) missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48,644,472 (GRCm39) unclassified probably benign
R7084:Zfp169 UTSW 13 48,652,339 (GRCm39) missense probably benign 0.10
R7933:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R8298:Zfp169 UTSW 13 48,651,853 (GRCm39) nonsense probably null
R8322:Zfp169 UTSW 13 48,644,575 (GRCm39) missense unknown
R9047:Zfp169 UTSW 13 48,652,292 (GRCm39) missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9126:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9131:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9132:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAGGCCTACAGAAGAGCTCC -3'
(R):5'- ATGTATTTCTAGGGGCGATTGACC -3'

Sequencing Primer
(F):5'- CCCTTAGCATGTCAGAGTAGGTC -3'
(R):5'- GATTGACCCTGCTTTTGACCTAGG -3'
Posted On 2019-11-12