Incidental Mutation 'R7679:Txndc15'
ID592663
Institutional Source Beutler Lab
Gene Symbol Txndc15
Ensembl Gene ENSMUSG00000021497
Gene Namethioredoxin domain containing 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7679 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55714650-55726227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55725808 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 327 (R327L)
Ref Sequence ENSEMBL: ENSMUSP00000021959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021958] [ENSMUST00000021959] [ENSMUST00000124968]
Predicted Effect probably benign
Transcript: ENSMUST00000021958
SMART Domains Protein: ENSMUSP00000021958
Gene: ENSMUSG00000021496

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Pterin_4a 39 132 1.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021959
AA Change: R327L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021959
Gene: ENSMUSG00000021497
AA Change: R327L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin 174 278 8.6e-11 PFAM
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124968
SMART Domains Protein: ENSMUSP00000115392
Gene: ENSMUSG00000021496

DomainStartEndE-ValueType
Pfam:Pterin_4a 3 101 5.7e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,514,816 Y206D Het
Atm A T 9: 53,442,497 I2906N probably damaging Het
B4galnt4 T C 7: 141,067,765 V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,820,643 probably null Het
Ccar2 G A 14: 70,139,235 Q887* probably null Het
Cdh13 A G 8: 119,236,919 I413V probably benign Het
Cfap54 A G 10: 92,967,512 V1556A probably benign Het
Chchd7 A T 4: 3,941,297 N14Y probably damaging Het
Col24a1 C A 3: 145,399,355 T824N possibly damaging Het
Col6a3 A T 1: 90,811,751 Y859N possibly damaging Het
Dnaaf5 C T 5: 139,150,637 P131S unknown Het
Erh T C 12: 80,637,571 N44S probably benign Het
Esm1 T A 13: 113,210,112 D90E probably damaging Het
Fbxo44 A G 4: 148,153,632 F213L probably benign Het
Flnc A G 6: 29,456,790 T2262A probably benign Het
Fmo9 T C 1: 166,667,489 Q281R probably benign Het
Gdpgp1 G T 7: 80,238,576 E118D probably benign Het
Gnas A T 2: 174,284,831 Q53L probably damaging Het
Gpr142 G A 11: 114,806,707 V360M possibly damaging Het
Grn A G 11: 102,433,069 D46G probably benign Het
H2-T10 A G 17: 36,119,324 F242L not run Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Hoxa9 A G 6: 52,224,308 I251T probably damaging Het
Inpp5f C T 7: 128,694,523 T866I possibly damaging Het
Itgb1 T A 8: 128,720,448 N481K probably damaging Het
Leng9 C A 7: 4,149,660 D6Y probably benign Het
Lox A C 18: 52,525,106 F332V possibly damaging Het
Lrp1 G T 10: 127,588,428 Y796* probably null Het
Lrrc32 G A 7: 98,499,687 G558D possibly damaging Het
Lrrk2 A G 15: 91,726,186 E707G possibly damaging Het
Matn4 A G 2: 164,389,658 *625R probably null Het
Mcur1 T A 13: 43,544,483 K314* probably null Het
Med1 G C 11: 98,156,061 P1303R unknown Het
Mgam T C 6: 40,643,046 L23P probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nfatc1 T C 18: 80,607,990 I936V probably benign Het
Nol11 T C 11: 107,173,316 S557G probably benign Het
Palb2 A G 7: 122,128,014 I211T probably benign Het
Pard3 T C 8: 127,371,846 V456A probably benign Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pik3cb T C 9: 99,088,607 K344E probably benign Het
Pik3r3 T A 4: 116,256,195 M45K probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pot1a A G 6: 25,771,634 V196A probably benign Het
Ppp1r32 T C 19: 10,482,254 T30A probably damaging Het
Prkdc T A 16: 15,831,319 I3719N probably damaging Het
Psg16 G A 7: 17,093,760 G123S probably damaging Het
Psme4 A G 11: 30,878,425 D1815G probably damaging Het
Rpe65 C T 3: 159,604,393 T101I probably damaging Het
Rpp25l A C 4: 41,712,326 C150G unknown Het
Serpina1b A T 12: 103,730,515 W212R probably damaging Het
Slc9a3 G A 13: 74,160,276 R466H possibly damaging Het
Sned1 T C 1: 93,236,038 L17P unknown Het
Speg C T 1: 75,406,315 T1056I probably damaging Het
Tada1 T C 1: 166,391,971 F281L probably benign Het
Tbcd G A 11: 121,603,708 V1032I probably benign Het
Tlr3 A T 8: 45,399,051 S270T probably benign Het
Zfp169 G C 13: 48,498,383 L66V probably damaging Het
Zfp442 G T 2: 150,410,997 Y45* probably null Het
Zzef1 A G 11: 72,893,278 D2003G probably benign Het
Other mutations in Txndc15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Txndc15 APN 13 55725675 missense probably damaging 1.00
IGL01634:Txndc15 APN 13 55721625 missense probably damaging 0.99
PIT4791001:Txndc15 UTSW 13 55721694 missense probably benign 0.39
R0309:Txndc15 UTSW 13 55724582 missense probably damaging 1.00
R0480:Txndc15 UTSW 13 55724623 missense possibly damaging 0.91
R1473:Txndc15 UTSW 13 55721574 splice site probably benign
R1856:Txndc15 UTSW 13 55718062 missense possibly damaging 0.80
R4456:Txndc15 UTSW 13 55718164 missense possibly damaging 0.82
R4945:Txndc15 UTSW 13 55718165 missense probably benign 0.01
R5159:Txndc15 UTSW 13 55717921 missense probably benign
R5376:Txndc15 UTSW 13 55718219 missense probably damaging 1.00
R5776:Txndc15 UTSW 13 55718107 missense probably benign 0.01
R7365:Txndc15 UTSW 13 55714788 missense unknown
R7392:Txndc15 UTSW 13 55721586 missense probably damaging 1.00
R7557:Txndc15 UTSW 13 55717954 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCATCATACTTCAGACAAGCCTC -3'
(R):5'- CAGCTTTTCAGTAGTCCAACAAG -3'

Sequencing Primer
(F):5'- TTCAGACAAGCCTCAGATGTG -3'
(R):5'- TCAGTAGTCCAACAAGAACATGATTC -3'
Posted On2019-11-12