Incidental Mutation 'R7680:Dnah14'
ID 592678
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms Dnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7680 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181576559-181815774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181685800 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1906 (N1906S)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: N1906S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,839,208 D104G possibly damaging Het
Ahi1 G T 10: 21,007,768 C844F possibly damaging Het
AI464131 C A 4: 41,497,978 D551Y probably damaging Het
B230118H07Rik T C 2: 101,610,556 E34G probably damaging Het
Bspry T C 4: 62,496,591 *474Q probably null Het
Car9 T A 4: 43,507,250 D65E probably damaging Het
Ccdc110 T A 8: 45,941,651 M193K possibly damaging Het
Ccdc166 A G 15: 75,981,207 S304P possibly damaging Het
Cdcp1 T C 9: 123,183,519 Q321R probably damaging Het
Cic T C 7: 25,292,431 V2255A probably damaging Het
Cmc2 A T 8: 116,894,110 M44K probably damaging Het
Crls1 A G 2: 132,862,338 T223A probably damaging Het
Ctnna3 A T 10: 64,487,550 H488L probably benign Het
Cyp2r1 A T 7: 114,552,819 I301N probably damaging Het
Dkk3 A T 7: 112,119,363 L272Q probably damaging Het
Gm13271 T C 4: 88,755,130 V88A probably benign Het
Gphn C A 12: 78,412,374 L79I probably benign Het
Gpr15 A T 16: 58,717,965 W254R probably damaging Het
H2-M2 T C 17: 37,483,025 R103G possibly damaging Het
Hcn4 T C 9: 58,860,671 S1172P probably benign Het
Htr1a A G 13: 105,445,031 S260G probably benign Het
Kif21b G T 1: 136,147,869 probably null Het
Lamp1 T C 8: 13,167,812 Y131H probably benign Het
Lrrc47 A C 4: 154,016,101 N378T probably benign Het
Manea A T 4: 26,340,649 H104Q probably damaging Het
Map4k3 A G 17: 80,581,876 I888T probably benign Het
Mark3 T C 12: 111,646,773 M557T probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh6 C A 14: 54,948,733 C1413F possibly damaging Het
Ncr1 T A 7: 4,338,124 M38K possibly damaging Het
Nid2 A G 14: 19,779,647 T669A probably damaging Het
Olfr49 T A 14: 54,282,380 I172F probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekha7 A G 7: 116,164,276 Y364H probably benign Het
Plxnb1 T A 9: 109,100,503 Y142* probably null Het
Ptprn T C 1: 75,247,893 I940V probably benign Het
Rnf213 T C 11: 119,479,556 V4728A Het
Samd9l A T 6: 3,372,569 L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 I264T probably damaging Het
Slc16a7 T C 10: 125,230,936 D278G probably benign Het
Slc35f2 T A 9: 53,808,112 V214E probably damaging Het
Slc7a5 A C 8: 121,907,267 S114A probably damaging Het
St6galnac3 A G 3: 153,205,410 S305P probably damaging Het
Stat1 G A 1: 52,144,209 R378Q probably damaging Het
Tnfrsf9 T G 4: 150,929,938 C31W probably damaging Het
Tnk1 T C 11: 69,856,745 E61G possibly damaging Het
Tnks1bp1 T A 2: 85,059,241 D637E probably benign Het
Ttc17 C T 2: 94,366,544 G486D probably benign Het
Vmn1r30 T A 6: 58,435,299 R183* probably null Het
Vmn2r78 A G 7: 86,954,941 T776A probably damaging Het
Wrap73 A G 4: 154,156,622 E444G probably benign Het
Zc3h13 C T 14: 75,330,515 R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
R8520:Dnah14 UTSW 1 181653638 missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181664946 missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181666011 nonsense probably null
R8710:Dnah14 UTSW 1 181690311 missense probably benign 0.04
R8752:Dnah14 UTSW 1 181628016 missense probably benign 0.00
R8792:Dnah14 UTSW 1 181814624 missense
R8797:Dnah14 UTSW 1 181637847 missense probably benign 0.19
R8821:Dnah14 UTSW 1 181792004 nonsense probably null
R8834:Dnah14 UTSW 1 181616750 missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181725498 missense probably benign 0.01
R8925:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181622723 missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9169:Dnah14 UTSW 1 181605816 missense probably benign 0.06
R9199:Dnah14 UTSW 1 181651001 missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181801287 missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181616640 critical splice donor site probably null
R9271:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9282:Dnah14 UTSW 1 181814512 missense
R9350:Dnah14 UTSW 1 181734804 missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181709033 missense probably benign 0.01
R9436:Dnah14 UTSW 1 181680783 missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181690208 missense probably benign 0.45
R9484:Dnah14 UTSW 1 181797746 missense probably benign 0.01
R9486:Dnah14 UTSW 1 181680929 missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181674442 missense probably benign 0.16
R9654:Dnah14 UTSW 1 181766339 missense probably benign 0.01
R9681:Dnah14 UTSW 1 181734849 missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181598944 missense probably benign 0.01
R9687:Dnah14 UTSW 1 181598413 missense probably benign 0.01
R9718:Dnah14 UTSW 1 181622979 missense probably benign 0.08
R9751:Dnah14 UTSW 1 181792045 missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181685784 missense probably benign 0.03
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATATAGGATCCTCAGTTACGGATAG -3'
(R):5'- CTGTAAGAGTTGTGGTATGAACAG -3'

Sequencing Primer
(F):5'- CCTCAGTTACGGATAGTATTAAATGC -3'
(R):5'- CAGAGATTTTAAGCAAACACACAGG -3'
Posted On 2019-11-12