Incidental Mutation 'R7680:Tnks1bp1'
ID592679
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Nametankyrase 1 binding protein 1
SynonymsTAB182
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7680 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85048022-85073048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85059241 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 637 (D637E)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
Predicted Effect probably benign
Transcript: ENSMUST00000048400
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111605
AA Change: D637E

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: D637E

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,839,208 D104G possibly damaging Het
Ahi1 G T 10: 21,007,768 C844F possibly damaging Het
AI464131 C A 4: 41,497,978 D551Y probably damaging Het
B230118H07Rik T C 2: 101,610,556 E34G probably damaging Het
Bspry T C 4: 62,496,591 *474Q probably null Het
Car9 T A 4: 43,507,250 D65E probably damaging Het
Ccdc110 T A 8: 45,941,651 M193K possibly damaging Het
Ccdc166 A G 15: 75,981,207 S304P possibly damaging Het
Cdcp1 T C 9: 123,183,519 Q321R probably damaging Het
Cic T C 7: 25,292,431 V2255A probably damaging Het
Cmc2 A T 8: 116,894,110 M44K probably damaging Het
Crls1 A G 2: 132,862,338 T223A probably damaging Het
Ctnna3 A T 10: 64,487,550 H488L probably benign Het
Cyp2r1 A T 7: 114,552,819 I301N probably damaging Het
Dkk3 A T 7: 112,119,363 L272Q probably damaging Het
Dnah14 A G 1: 181,685,800 N1906S probably benign Het
Gm13271 T C 4: 88,755,130 V88A probably benign Het
Gphn C A 12: 78,412,374 L79I probably benign Het
Gpr15 A T 16: 58,717,965 W254R probably damaging Het
H2-M2 T C 17: 37,483,025 R103G possibly damaging Het
Hcn4 T C 9: 58,860,671 S1172P probably benign Het
Htr1a A G 13: 105,445,031 S260G probably benign Het
Kif21b G T 1: 136,147,869 probably null Het
Lamp1 T C 8: 13,167,812 Y131H probably benign Het
Lrrc47 A C 4: 154,016,101 N378T probably benign Het
Manea A T 4: 26,340,649 H104Q probably damaging Het
Map4k3 A G 17: 80,581,876 I888T probably benign Het
Mark3 T C 12: 111,646,773 M557T probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh6 C A 14: 54,948,733 C1413F possibly damaging Het
Ncr1 T A 7: 4,338,124 M38K possibly damaging Het
Nid2 A G 14: 19,779,647 T669A probably damaging Het
Olfr49 T A 14: 54,282,380 I172F probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekha7 A G 7: 116,164,276 Y364H probably benign Het
Plxnb1 T A 9: 109,100,503 Y142* probably null Het
Ptprn T C 1: 75,247,893 I940V probably benign Het
Rnf213 T C 11: 119,479,556 V4728A Het
Samd9l A T 6: 3,372,569 L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 I264T probably damaging Het
Slc16a7 T C 10: 125,230,936 D278G probably benign Het
Slc35f2 T A 9: 53,808,112 V214E probably damaging Het
Slc7a5 A C 8: 121,907,267 S114A probably damaging Het
St6galnac3 A G 3: 153,205,410 S305P probably damaging Het
Stat1 G A 1: 52,144,209 R378Q probably damaging Het
Tnfrsf9 T G 4: 150,929,938 C31W probably damaging Het
Tnk1 T C 11: 69,856,745 E61G possibly damaging Het
Ttc17 C T 2: 94,366,544 G486D probably benign Het
Vmn1r30 T A 6: 58,435,299 R183* probably null Het
Vmn2r78 A G 7: 86,954,941 T776A probably damaging Het
Wrap73 A G 4: 154,156,622 E444G probably benign Het
Zc3h13 C T 14: 75,330,515 R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.92
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6516:Tnks1bp1 UTSW 2 85070727 missense probably damaging 0.97
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
Z1176:Tnks1bp1 UTSW 2 85063530
Z1177:Tnks1bp1 UTSW 2 85059003
Predicted Primers PCR Primer
(F):5'- GATGATGGAGAGAGTCAGCCTC -3'
(R):5'- GGTGATGCTAGGAGGTCATC -3'

Sequencing Primer
(F):5'- TCTACAGTTGAGGGCCCAC -3'
(R):5'- AGGTCATCCAGCCATCGAG -3'
Posted On2019-11-12