Mutagenetix > Incidental Mutation

Incidental Mutation 'R0239:Sec31b'

59268

Institutional Source

Beutler Lab

Gene Symbol

Sec31b

Ensembl Gene

ENSMUSG00000051984

Gene Name

Sec31 homolog B (S. cerevisiae)

Synonyms

LOC240667, Sec31l2

MMRRC Submission

038477-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R0239 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44516957-44545864 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 44525469 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]

AlphaFold

Q3TZ89

Predicted Effect

probably benign
Transcript: ENSMUST00000063632

SMART Domains

Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
Blast:WD40	56	101	5e-18	BLAST
WD40	110	150	4.76e-6	SMART
WD40	159	197	1.53e1	SMART
WD40	200	245	1.85e0	SMART
WD40	249	289	2.15e-4	SMART
WD40	292	332	6.19e-1	SMART
low complexity region	551	561	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	909	929	N/A	INTRINSIC
low complexity region	1009	1018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111985

SMART Domains

Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
WD40	2	40	1.53e1	SMART
WD40	43	88	1.85e0	SMART
WD40	92	132	2.15e-4	SMART
WD40	135	175	6.19e-1	SMART
Pfam:Sec16_C	394	612	1.3e-7	PFAM
low complexity region	665	684	N/A	INTRINSIC
low complexity region	752	772	N/A	INTRINSIC
low complexity region	852	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165758

SMART Domains

Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
low complexity region	17	36	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 99.0%
10x: 97.9%
20x: 96.2%

Validation Efficiency

98% (81/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adra1d	C	A	2: 131,546,214	V474F	probably benign	Het
Alg8	A	T	7: 97,383,684		probably null	Het
Ash1l	A	G	3: 89,067,222	D2618G	possibly damaging	Het
Atp6v1c2	C	A	12: 17,294,675		probably null	Het
Cacna1d	A	G	14: 30,123,496	V572A	probably benign	Het
Camta1	A	G	4: 151,143,730	W882R	probably damaging	Het
Cd72	A	G	4: 43,453,163	V91A	probably benign	Het
Cdh12	T	C	15: 21,586,407	W771R	probably damaging	Het
Cdx2	G	T	5: 147,303,287	T193K	probably damaging	Het
Cfap70	A	C	14: 20,448,605	S5A	probably benign	Het
Chmp7	A	G	14: 69,720,997	V241A	probably damaging	Het
Col4a1	C	T	8: 11,218,780		probably benign	Het
D3Ertd751e	A	G	3: 41,753,878	Y150C	probably damaging	Het
Depdc5	T	C	5: 32,943,240	S832P	probably damaging	Het
Dnhd1	A	G	7: 105,721,531	S4673G	probably benign	Het
Dock4	G	T	12: 40,737,540	S818I	probably damaging	Het
Dysf	C	T	6: 84,064,479	Q156*	probably null	Het
Espnl	T	C	1: 91,322,287	V52A	probably damaging	Het
Flcn	T	C	11: 59,801,076	N249S	probably benign	Het
Gemin6	C	A	17: 80,225,710	A24D	probably damaging	Het
Gm5773	A	G	3: 93,774,032	H337R	probably benign	Het
Gm9733	A	G	3: 15,296,601	L163P	probably damaging	Het
Greb1l	C	T	18: 10,458,567		probably benign	Het
Hal	T	C	10: 93,503,482	S478P	possibly damaging	Het
Hectd1	T	A	12: 51,769,318	M1324L	possibly damaging	Het
Hyal5	T	A	6: 24,876,344	L72Q	probably damaging	Het
Ift140	C	A	17: 25,045,523	C557*	probably null	Het
Ikbkap	C	A	4: 56,784,596	V466L	probably benign	Het
Il4ra	T	C	7: 125,575,199		probably benign	Het
Ipo9	A	G	1: 135,404,336		probably benign	Het
Kbtbd3	G	T	9: 4,330,144	V173L	possibly damaging	Het
Kif14	A	G	1: 136,527,393	E1551G	probably damaging	Het
Klc1	A	G	12: 111,785,324		probably benign	Het
Krt17	G	A	11: 100,260,878	R30*	probably null	Het
Lamb3	A	T	1: 193,321,053	D100V	probably damaging	Het
Lrmp	G	A	6: 145,171,978		probably benign	Het
Map2	A	G	1: 66,416,106	D1385G	probably damaging	Het
Mettl25	C	T	10: 105,826,525	V195I	probably damaging	Het
Mfsd7a	G	T	5: 108,444,016		probably benign	Het
Micu2	G	A	14: 57,917,378		probably benign	Het
Mrrf	T	C	2: 36,177,281		probably benign	Het
Myh8	A	G	11: 67,301,692	T1466A	probably benign	Het
Myo3b	T	A	2: 70,105,425	C61S	probably benign	Het
Nacc2	T	G	2: 26,062,261	N361T	probably damaging	Het
Nf1	A	T	11: 79,418,574	K438M	possibly damaging	Het
Nipal4	A	G	11: 46,150,441	V309A	possibly damaging	Het
Nomo1	T	C	7: 46,079,594		probably null	Het
Nubp2	T	C	17: 24,884,471	E144G	probably damaging	Het
Nwd2	A	T	5: 63,800,124	I266F	probably benign	Het
Olfr1126	T	C	2: 87,458,037	F291L	probably benign	Het
Olfr593	G	A	7: 103,212,726	V289M	possibly damaging	Het
Olfr694	A	G	7: 106,689,255	Y159H	probably benign	Het
Orc1	T	C	4: 108,595,646		probably null	Het
Otogl	T	A	10: 107,806,696	N1291I	probably damaging	Het
Pah	C	T	10: 87,567,281	P173S	possibly damaging	Het
Pga5	A	G	19: 10,669,453	Y305H	probably damaging	Het
Plekha4	A	G	7: 45,532,358	H62R	probably damaging	Het
Plxnd1	G	T	6: 115,968,793	D906E	probably benign	Het
Ppfia4	T	C	1: 134,329,189	E98G	possibly damaging	Het
Ptk2	A	T	15: 73,343,283		probably null	Het
Pzp	C	T	6: 128,489,156		probably benign	Het
Raet1c	C	A	10: 22,180,862	H112Q	possibly damaging	Het
Scai	T	A	2: 39,075,042	I597F	probably benign	Het
Scgb1b2	T	A	7: 31,291,730		probably benign	Het
Slc35c2	C	T	2: 165,280,837	G176S	probably damaging	Het
Slc35f4	A	T	14: 49,304,256	I347N	possibly damaging	Het
Slc52a3	T	C	2: 152,008,156	*461Q	probably null	Het
Slc6a1	G	A	6: 114,302,800	V142I	probably benign	Het
Tbc1d31	C	A	15: 57,940,753	T388N	probably benign	Het
Tmem131	T	C	1: 36,828,050		probably benign	Het
Tmem63c	T	C	12: 87,075,639	W404R	probably damaging	Het
Tmem79	A	G	3: 88,333,321	S107P	probably benign	Het
Trip11	C	T	12: 101,884,728	E741K	probably damaging	Het
Trpm5	G	T	7: 143,082,958	T414N	probably damaging	Het
Tsnaxip1	T	A	8: 105,844,488	I660N	possibly damaging	Het
Ube2q2	T	C	9: 55,163,007	S78P	probably damaging	Het
Vac14	A	T	8: 110,635,375		probably null	Het
Vps51	G	T	19: 6,071,437	S185*	probably null	Het
Zfp11	C	T	5: 129,658,238	G53E	possibly damaging	Het
Zfp532	A	T	18: 65,682,985	I810F	possibly damaging	Het
Zfp599	C	T	9: 22,249,759	C370Y	probably damaging	Het

Other mutations in Sec31b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Sec31b	APN	19	44527041	missense	probably damaging	1.00
IGL01308:Sec31b	APN	19	44523683	missense	probably benign	0.02
IGL02404:Sec31b	APN	19	44534788	missense	probably damaging	0.99
IGL02663:Sec31b	APN	19	44534278	missense	probably damaging	1.00
IGL02728:Sec31b	APN	19	44523115	missense	probably damaging	0.96
IGL02830:Sec31b	APN	19	44531703	missense	probably damaging	1.00
IGL03141:Sec31b	APN	19	44526320	splice site	probably benign
IGL03247:Sec31b	APN	19	44518940	missense	possibly damaging	0.62
R0049:Sec31b	UTSW	19	44520408	splice site	probably benign
R0137:Sec31b	UTSW	19	44534382	missense	probably damaging	1.00
R0238:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0468:Sec31b	UTSW	19	44518508	splice site	probably benign
R0504:Sec31b	UTSW	19	44534786	missense	probably damaging	1.00
R0565:Sec31b	UTSW	19	44524553	missense	probably damaging	1.00
R0627:Sec31b	UTSW	19	44525607	missense	probably benign
R0749:Sec31b	UTSW	19	44524506	missense	probably damaging	0.96
R0815:Sec31b	UTSW	19	44518173	nonsense	probably null
R1162:Sec31b	UTSW	19	44517648	nonsense	probably null
R1398:Sec31b	UTSW	19	44523665	missense	probably benign	0.04
R1436:Sec31b	UTSW	19	44536195	missense	probably damaging	0.99
R1538:Sec31b	UTSW	19	44518586	missense	probably benign	0.42
R1599:Sec31b	UTSW	19	44523153	missense	possibly damaging	0.92
R2044:Sec31b	UTSW	19	44536156	missense	probably benign	0.07
R2135:Sec31b	UTSW	19	44534696	missense	probably damaging	0.99
R2167:Sec31b	UTSW	19	44543353	missense	possibly damaging	0.89
R2211:Sec31b	UTSW	19	44523150	missense	probably damaging	1.00
R2938:Sec31b	UTSW	19	44536179	missense	probably damaging	0.99
R3113:Sec31b	UTSW	19	44518185	nonsense	probably null
R4110:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4111:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4113:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4158:Sec31b	UTSW	19	44525186	missense	probably benign	0.34
R4226:Sec31b	UTSW	19	44531710	missense	probably benign
R4646:Sec31b	UTSW	19	44526621	missense	probably benign	0.00
R4732:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4733:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4795:Sec31b	UTSW	19	44531746	missense	probably benign	0.00
R4877:Sec31b	UTSW	19	44535733	missense	probably damaging	1.00
R5150:Sec31b	UTSW	19	44520531	missense	probably benign	0.08
R5377:Sec31b	UTSW	19	44518637	missense	probably damaging	1.00
R5381:Sec31b	UTSW	19	44534371	missense	probably damaging	1.00
R5708:Sec31b	UTSW	19	44523144	missense	probably damaging	1.00
R6002:Sec31b	UTSW	19	44535764	missense	probably benign	0.04
R6185:Sec31b	UTSW	19	44543284	missense	possibly damaging	0.77
R6675:Sec31b	UTSW	19	44523775	missense	probably benign
R6946:Sec31b	UTSW	19	44534316	missense	probably damaging	1.00
R7139:Sec31b	UTSW	19	44518936	missense	probably benign	0.00
R7237:Sec31b	UTSW	19	44517708	missense	probably damaging	1.00
R7270:Sec31b	UTSW	19	44523043	missense	probably benign	0.00
R7340:Sec31b	UTSW	19	44528722	missense	probably benign	0.00
R7505:Sec31b	UTSW	19	44543707	missense	probably damaging	1.00
R7584:Sec31b	UTSW	19	44543323	missense	probably damaging	0.99
R7584:Sec31b	UTSW	19	44531556	splice site	probably null
R7763:Sec31b	UTSW	19	44523835	critical splice acceptor site	probably null
R7777:Sec31b	UTSW	19	44523773	nonsense	probably null
R7900:Sec31b	UTSW	19	44526230	missense	probably damaging	1.00
R7952:Sec31b	UTSW	19	44520540	missense	probably benign	0.01
R8057:Sec31b	UTSW	19	44519365	missense	probably damaging	1.00
R8197:Sec31b	UTSW	19	44524516	missense	probably benign	0.25
R8739:Sec31b	UTSW	19	44519181	missense	probably benign	0.16
R8822:Sec31b	UTSW	19	44519263	missense	probably benign	0.02
R8837:Sec31b	UTSW	19	44517667	nonsense	probably null
R8916:Sec31b	UTSW	19	44532344	missense
R9069:Sec31b	UTSW	19	44519302	missense	probably damaging	0.98
R9259:Sec31b	UTSW	19	44517416	missense	probably damaging	1.00
R9493:Sec31b	UTSW	19	44520582	missense	probably damaging	1.00
RF023:Sec31b	UTSW	19	44535787	missense	probably damaging	1.00
Z1177:Sec31b	UTSW	19	44517314	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGTTCTTCAGCCTACAGGCAC -3'
(R):5'- GCAGAGGAAGCCTTCACTTCTCAG -3'

Sequencing Primer
(F):5'- TTTACAACACAGGCTAGAAGCTG -3'
(R):5'- TGCAGACACTGATGGACTC -3'

Posted On

2013-07-11