Incidental Mutation 'R7680:Wrap73'
ID592692
Institutional Source Beutler Lab
Gene Symbol Wrap73
Ensembl Gene ENSMUSG00000029029
Gene NameWD repeat containing, antisense to Trp73
SynonymsDD57, Wdr8, 5330425N03Rik, 2610044M17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R7680 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location154142372-154167420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154156622 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 444 (E444G)
Ref Sequence ENSEMBL: ENSMUSP00000030895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030895] [ENSMUST00000030896] [ENSMUST00000105639]
Predicted Effect probably benign
Transcript: ENSMUST00000030895
AA Change: E444G

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029
AA Change: E444G

DomainStartEndE-ValueType
Blast:WD40 38 77 4e-18 BLAST
Blast:WD40 81 120 6e-16 BLAST
Blast:WD40 125 163 9e-6 BLAST
WD40 167 208 2.28e2 SMART
WD40 215 251 1.58e-2 SMART
WD40 319 360 2.29e1 SMART
WD40 363 401 4.18e-2 SMART
Blast:WD40 402 443 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030896
SMART Domains Protein: ENSMUSP00000030896
Gene: ENSMUSG00000029030

DomainStartEndE-ValueType
Pfam:hSac2 56 163 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105639
SMART Domains Protein: ENSMUSP00000101264
Gene: ENSMUSG00000029030

DomainStartEndE-ValueType
Pfam:hSac2 53 106 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146734
SMART Domains Protein: ENSMUSP00000118548
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
WD40 28 64 1.58e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Studies of the related mouse protein suggest that the encoded protein may play a role in the process of ossification. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,839,208 D104G possibly damaging Het
Ahi1 G T 10: 21,007,768 C844F possibly damaging Het
AI464131 C A 4: 41,497,978 D551Y probably damaging Het
B230118H07Rik T C 2: 101,610,556 E34G probably damaging Het
Bspry T C 4: 62,496,591 *474Q probably null Het
Car9 T A 4: 43,507,250 D65E probably damaging Het
Ccdc110 T A 8: 45,941,651 M193K possibly damaging Het
Ccdc166 A G 15: 75,981,207 S304P possibly damaging Het
Cdcp1 T C 9: 123,183,519 Q321R probably damaging Het
Cic T C 7: 25,292,431 V2255A probably damaging Het
Cmc2 A T 8: 116,894,110 M44K probably damaging Het
Crls1 A G 2: 132,862,338 T223A probably damaging Het
Ctnna3 A T 10: 64,487,550 H488L probably benign Het
Cyp2r1 A T 7: 114,552,819 I301N probably damaging Het
Dkk3 A T 7: 112,119,363 L272Q probably damaging Het
Dnah14 A G 1: 181,685,800 N1906S probably benign Het
Gm13271 T C 4: 88,755,130 V88A probably benign Het
Gphn C A 12: 78,412,374 L79I probably benign Het
Gpr15 A T 16: 58,717,965 W254R probably damaging Het
H2-M2 T C 17: 37,483,025 R103G possibly damaging Het
Hcn4 T C 9: 58,860,671 S1172P probably benign Het
Htr1a A G 13: 105,445,031 S260G probably benign Het
Kif21b G T 1: 136,147,869 probably null Het
Lamp1 T C 8: 13,167,812 Y131H probably benign Het
Lrrc47 A C 4: 154,016,101 N378T probably benign Het
Manea A T 4: 26,340,649 H104Q probably damaging Het
Map4k3 A G 17: 80,581,876 I888T probably benign Het
Mark3 T C 12: 111,646,773 M557T probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh6 C A 14: 54,948,733 C1413F possibly damaging Het
Ncr1 T A 7: 4,338,124 M38K possibly damaging Het
Nid2 A G 14: 19,779,647 T669A probably damaging Het
Olfr49 T A 14: 54,282,380 I172F probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekha7 A G 7: 116,164,276 Y364H probably benign Het
Plxnb1 T A 9: 109,100,503 Y142* probably null Het
Ptprn T C 1: 75,247,893 I940V probably benign Het
Rnf213 T C 11: 119,479,556 V4728A Het
Samd9l A T 6: 3,372,569 L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 I264T probably damaging Het
Slc16a7 T C 10: 125,230,936 D278G probably benign Het
Slc35f2 T A 9: 53,808,112 V214E probably damaging Het
Slc7a5 A C 8: 121,907,267 S114A probably damaging Het
St6galnac3 A G 3: 153,205,410 S305P probably damaging Het
Stat1 G A 1: 52,144,209 R378Q probably damaging Het
Tnfrsf9 T G 4: 150,929,938 C31W probably damaging Het
Tnk1 T C 11: 69,856,745 E61G possibly damaging Het
Tnks1bp1 T A 2: 85,059,241 D637E probably benign Het
Ttc17 C T 2: 94,366,544 G486D probably benign Het
Vmn1r30 T A 6: 58,435,299 R183* probably null Het
Vmn2r78 A G 7: 86,954,941 T776A probably damaging Het
Zc3h13 C T 14: 75,330,515 R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Other mutations in Wrap73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Wrap73 APN 4 154152639 missense probably damaging 0.99
IGL01562:Wrap73 APN 4 154145337 missense possibly damaging 0.63
IGL01863:Wrap73 APN 4 154145333 missense probably benign 0.02
IGL02342:Wrap73 APN 4 154148780 missense probably benign 0.36
IGL03012:Wrap73 APN 4 154145234 splice site probably benign
IGL03303:Wrap73 APN 4 154146543 missense probably damaging 0.98
R0128:Wrap73 UTSW 4 154142500 missense possibly damaging 0.81
R0455:Wrap73 UTSW 4 154148743 missense possibly damaging 0.63
R0524:Wrap73 UTSW 4 154145307 missense probably damaging 1.00
R0528:Wrap73 UTSW 4 154145319 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154151649 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154156154 missense possibly damaging 0.91
R0633:Wrap73 UTSW 4 154142491 missense probably damaging 0.98
R1118:Wrap73 UTSW 4 154152427 splice site probably null
R1669:Wrap73 UTSW 4 154156131 missense probably damaging 0.99
R1725:Wrap73 UTSW 4 154148752 missense possibly damaging 0.73
R2070:Wrap73 UTSW 4 154148743 missense possibly damaging 0.63
R4530:Wrap73 UTSW 4 154156707 unclassified probably benign
R4669:Wrap73 UTSW 4 154151696 missense probably benign 0.26
R4969:Wrap73 UTSW 4 154152681 missense probably damaging 1.00
R5254:Wrap73 UTSW 4 154155346 missense probably benign 0.00
R5334:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5428:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5431:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5728:Wrap73 UTSW 4 154154642 critical splice donor site probably null
R7338:Wrap73 UTSW 4 154152586 missense probably benign 0.26
R7426:Wrap73 UTSW 4 154156127 missense probably damaging 1.00
R7480:Wrap73 UTSW 4 154152586 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCTGTCCTTAAGGTTTACTGGC -3'
(R):5'- TGTGAGCTAAGGCCTTGAAG -3'

Sequencing Primer
(F):5'- AAGGTTTACTGGCTTTGTCTTCAGC -3'
(R):5'- CACCACTGTTCAATGGATTAGC -3'
Posted On2019-11-12