Incidental Mutation 'R7680:Vmn2r78'
ID 592698
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Name vomeronasal 2, receptor 78
Synonyms
MMRRC Submission 045746-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R7680 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 86564557-86604385 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86604149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 776 (T776A)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
AlphaFold K7N6U5
Predicted Effect probably damaging
Transcript: ENSMUST00000170835
AA Change: T776A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: T776A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,657,958 (GRCm39) D104G possibly damaging Het
Ahi1 G T 10: 20,883,667 (GRCm39) C844F possibly damaging Het
Bspry T C 4: 62,414,828 (GRCm39) *474Q probably null Het
Car9 T A 4: 43,507,250 (GRCm39) D65E probably damaging Het
Ccdc110 T A 8: 46,394,688 (GRCm39) M193K possibly damaging Het
Ccdc166 A G 15: 75,853,056 (GRCm39) S304P possibly damaging Het
Cdcp1 T C 9: 123,012,584 (GRCm39) Q321R probably damaging Het
Cic T C 7: 24,991,856 (GRCm39) V2255A probably damaging Het
Cmc2 A T 8: 117,620,849 (GRCm39) M44K probably damaging Het
Crls1 A G 2: 132,704,258 (GRCm39) T223A probably damaging Het
Ctnna3 A T 10: 64,323,329 (GRCm39) H488L probably benign Het
Cyp2r1 A T 7: 114,152,054 (GRCm39) I301N probably damaging Het
Dkk3 A T 7: 111,718,570 (GRCm39) L272Q probably damaging Het
Dnah14 A G 1: 181,513,365 (GRCm39) N1906S probably benign Het
Gm13271 T C 4: 88,673,367 (GRCm39) V88A probably benign Het
Gphn C A 12: 78,459,148 (GRCm39) L79I probably benign Het
Gpr15 A T 16: 58,538,328 (GRCm39) W254R probably damaging Het
H2-M2 T C 17: 37,793,916 (GRCm39) R103G possibly damaging Het
Hcn4 T C 9: 58,767,954 (GRCm39) S1172P probably benign Het
Htr1a A G 13: 105,581,539 (GRCm39) S260G probably benign Het
Iftap T C 2: 101,440,901 (GRCm39) E34G probably damaging Het
Kif21b G T 1: 136,075,607 (GRCm39) probably null Het
Lamp1 T C 8: 13,217,812 (GRCm39) Y131H probably benign Het
Lrrc47 A C 4: 154,100,558 (GRCm39) N378T probably benign Het
Manea A T 4: 26,340,649 (GRCm39) H104Q probably damaging Het
Map4k3 A G 17: 80,889,305 (GRCm39) I888T probably benign Het
Mark3 T C 12: 111,613,207 (GRCm39) M557T probably benign Het
Muc6 G C 7: 141,217,659 (GRCm39) P2338R probably damaging Het
Myh6 C A 14: 55,186,190 (GRCm39) C1413F possibly damaging Het
Myorg C A 4: 41,497,978 (GRCm39) D551Y probably damaging Het
Ncr1 T A 7: 4,341,123 (GRCm39) M38K possibly damaging Het
Nid2 A G 14: 19,829,715 (GRCm39) T669A probably damaging Het
Or6e1 T A 14: 54,519,837 (GRCm39) I172F probably damaging Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Plekha7 A G 7: 115,763,511 (GRCm39) Y364H probably benign Het
Plxnb1 T A 9: 108,929,571 (GRCm39) Y142* probably null Het
Ptprn T C 1: 75,224,537 (GRCm39) I940V probably benign Het
Rnf213 T C 11: 119,370,382 (GRCm39) V4728A Het
Samd9l A T 6: 3,372,569 (GRCm39) L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 (GRCm39) I264T probably damaging Het
Slc16a7 T C 10: 125,066,805 (GRCm39) D278G probably benign Het
Slc35f2 T A 9: 53,715,396 (GRCm39) V214E probably damaging Het
Slc7a5 A C 8: 122,634,006 (GRCm39) S114A probably damaging Het
St6galnac3 A G 3: 152,911,047 (GRCm39) S305P probably damaging Het
Stat1 G A 1: 52,183,368 (GRCm39) R378Q probably damaging Het
Tnfrsf9 T G 4: 151,014,395 (GRCm39) C31W probably damaging Het
Tnk1 T C 11: 69,747,571 (GRCm39) E61G possibly damaging Het
Tnks1bp1 T A 2: 84,889,585 (GRCm39) D637E probably benign Het
Ttc17 C T 2: 94,196,889 (GRCm39) G486D probably benign Het
Vmn1r30 T A 6: 58,412,284 (GRCm39) R183* probably null Het
Wrap73 A G 4: 154,241,079 (GRCm39) E444G probably benign Het
Zc3h13 C T 14: 75,567,955 (GRCm39) R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 (GRCm39) probably benign Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86,564,569 (GRCm39) missense unknown
IGL01473:Vmn2r78 APN 7 86,569,520 (GRCm39) missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86,603,643 (GRCm39) missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86,570,687 (GRCm39) missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86,603,496 (GRCm39) missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86,569,969 (GRCm39) nonsense probably null
ANU74:Vmn2r78 UTSW 7 86,570,273 (GRCm39) missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86,569,413 (GRCm39) missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86,572,235 (GRCm39) missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86,570,519 (GRCm39) missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86,603,588 (GRCm39) missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86,571,477 (GRCm39) missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86,564,615 (GRCm39) missense unknown
R1526:Vmn2r78 UTSW 7 86,571,465 (GRCm39) splice site probably null
R1712:Vmn2r78 UTSW 7 86,604,132 (GRCm39) missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86,569,997 (GRCm39) missense probably benign
R1812:Vmn2r78 UTSW 7 86,569,995 (GRCm39) missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86,604,287 (GRCm39) missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86,603,690 (GRCm39) missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86,570,535 (GRCm39) missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86,569,362 (GRCm39) missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86,569,953 (GRCm39) splice site probably benign
R3023:Vmn2r78 UTSW 7 86,604,174 (GRCm39) missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86,569,959 (GRCm39) critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86,569,452 (GRCm39) missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86,570,399 (GRCm39) missense probably benign
R4546:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86,603,916 (GRCm39) missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86,603,835 (GRCm39) missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86,571,563 (GRCm39) missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86,569,332 (GRCm39) missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86,570,238 (GRCm39) missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86,569,330 (GRCm39) missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86,570,737 (GRCm39) missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86,564,720 (GRCm39) missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86,603,637 (GRCm39) missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86,603,796 (GRCm39) missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86,604,115 (GRCm39) missense probably benign 0.00
R5977:Vmn2r78 UTSW 7 86,569,541 (GRCm39) missense possibly damaging 0.74
R6276:Vmn2r78 UTSW 7 86,570,318 (GRCm39) missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86,571,545 (GRCm39) nonsense probably null
R6724:Vmn2r78 UTSW 7 86,603,466 (GRCm39) missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86,603,811 (GRCm39) missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86,571,558 (GRCm39) missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86,571,633 (GRCm39) missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86,603,552 (GRCm39) nonsense probably null
R7748:Vmn2r78 UTSW 7 86,570,343 (GRCm39) missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86,569,378 (GRCm39) nonsense probably null
R8031:Vmn2r78 UTSW 7 86,604,075 (GRCm39) missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86,571,695 (GRCm39) missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86,603,998 (GRCm39) missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86,603,660 (GRCm39) missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86,570,094 (GRCm39) missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86,603,513 (GRCm39) missense possibly damaging 0.81
R9209:Vmn2r78 UTSW 7 86,569,431 (GRCm39) missense probably benign 0.08
RF018:Vmn2r78 UTSW 7 86,603,639 (GRCm39) nonsense probably null
Z1177:Vmn2r78 UTSW 7 86,603,982 (GRCm39) missense probably benign 0.02
Z1177:Vmn2r78 UTSW 7 86,570,415 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGGTGGCTGCTACTTTCAG -3'
(R):5'- GTGGTCTCAACAAAATAAGGTAGC -3'

Sequencing Primer
(F):5'- GAATCTGGCTGGGAACTTCTCC -3'
(R):5'- CAAAATAAGGTAGCACTTTGGCAC -3'
Posted On 2019-11-12