Incidental Mutation 'R7680:Slc35f2'
ID592708
Institutional Source Beutler Lab
Gene Symbol Slc35f2
Ensembl Gene ENSMUSG00000042195
Gene Namesolute carrier family 35, member F2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7680 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location53771538-53818154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53808112 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 214 (V214E)
Ref Sequence ENSEMBL: ENSMUSP00000046528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048670]
Predicted Effect probably damaging
Transcript: ENSMUST00000048670
AA Change: V214E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046528
Gene: ENSMUSG00000042195
AA Change: V214E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:SLC35F 35 334 7.2e-148 PFAM
Pfam:CRT-like 47 255 4.5e-14 PFAM
Pfam:EamA 196 334 2.1e-10 PFAM
low complexity region 339 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,839,208 D104G possibly damaging Het
Ahi1 G T 10: 21,007,768 C844F possibly damaging Het
AI464131 C A 4: 41,497,978 D551Y probably damaging Het
B230118H07Rik T C 2: 101,610,556 E34G probably damaging Het
Bspry T C 4: 62,496,591 *474Q probably null Het
Car9 T A 4: 43,507,250 D65E probably damaging Het
Ccdc110 T A 8: 45,941,651 M193K possibly damaging Het
Ccdc166 A G 15: 75,981,207 S304P possibly damaging Het
Cdcp1 T C 9: 123,183,519 Q321R probably damaging Het
Cic T C 7: 25,292,431 V2255A probably damaging Het
Cmc2 A T 8: 116,894,110 M44K probably damaging Het
Crls1 A G 2: 132,862,338 T223A probably damaging Het
Ctnna3 A T 10: 64,487,550 H488L probably benign Het
Cyp2r1 A T 7: 114,552,819 I301N probably damaging Het
Dkk3 A T 7: 112,119,363 L272Q probably damaging Het
Dnah14 A G 1: 181,685,800 N1906S probably benign Het
Gm13271 T C 4: 88,755,130 V88A probably benign Het
Gphn C A 12: 78,412,374 L79I probably benign Het
Gpr15 A T 16: 58,717,965 W254R probably damaging Het
H2-M2 T C 17: 37,483,025 R103G possibly damaging Het
Hcn4 T C 9: 58,860,671 S1172P probably benign Het
Htr1a A G 13: 105,445,031 S260G probably benign Het
Kif21b G T 1: 136,147,869 probably null Het
Lamp1 T C 8: 13,167,812 Y131H probably benign Het
Lrrc47 A C 4: 154,016,101 N378T probably benign Het
Manea A T 4: 26,340,649 H104Q probably damaging Het
Map4k3 A G 17: 80,581,876 I888T probably benign Het
Mark3 T C 12: 111,646,773 M557T probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh6 C A 14: 54,948,733 C1413F possibly damaging Het
Ncr1 T A 7: 4,338,124 M38K possibly damaging Het
Nid2 A G 14: 19,779,647 T669A probably damaging Het
Olfr49 T A 14: 54,282,380 I172F probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekha7 A G 7: 116,164,276 Y364H probably benign Het
Plxnb1 T A 9: 109,100,503 Y142* probably null Het
Ptprn T C 1: 75,247,893 I940V probably benign Het
Rnf213 T C 11: 119,479,556 V4728A Het
Samd9l A T 6: 3,372,569 L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 I264T probably damaging Het
Slc16a7 T C 10: 125,230,936 D278G probably benign Het
Slc7a5 A C 8: 121,907,267 S114A probably damaging Het
St6galnac3 A G 3: 153,205,410 S305P probably damaging Het
Stat1 G A 1: 52,144,209 R378Q probably damaging Het
Tnfrsf9 T G 4: 150,929,938 C31W probably damaging Het
Tnk1 T C 11: 69,856,745 E61G possibly damaging Het
Tnks1bp1 T A 2: 85,059,241 D637E probably benign Het
Ttc17 C T 2: 94,366,544 G486D probably benign Het
Vmn1r30 T A 6: 58,435,299 R183* probably null Het
Vmn2r78 A G 7: 86,954,941 T776A probably damaging Het
Wrap73 A G 4: 154,156,622 E444G probably benign Het
Zc3h13 C T 14: 75,330,515 R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Other mutations in Slc35f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slc35f2 APN 9 53798014 critical splice donor site probably null
IGL01476:Slc35f2 APN 9 53806706 missense possibly damaging 0.88
IGL01732:Slc35f2 APN 9 53806625 missense probably damaging 1.00
IGL02719:Slc35f2 APN 9 53809742 splice site probably benign
R0449:Slc35f2 UTSW 9 53816917 missense probably damaging 1.00
R1268:Slc35f2 UTSW 9 53797913 nonsense probably null
R1539:Slc35f2 UTSW 9 53809708 missense possibly damaging 0.66
R3886:Slc35f2 UTSW 9 53816957 missense probably benign 0.00
R4748:Slc35f2 UTSW 9 53771785 start codon destroyed probably benign 0.23
R4779:Slc35f2 UTSW 9 53809729 missense possibly damaging 0.80
R5438:Slc35f2 UTSW 9 53801018 missense probably benign
R7308:Slc35f2 UTSW 9 53798010 missense probably benign 0.00
R7520:Slc35f2 UTSW 9 53801101 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- AAACGGTGTCAGTGTTGTGCC -3'
(R):5'- GTAAGTCACTCCCCATCCCTGA -3'

Sequencing Primer
(F):5'- GCCTTTAGACTTACAGAAGCTAGG -3'
(R):5'- GATTGTCCTGCCCTCTGC -3'
Posted On2019-11-12