Incidental Mutation 'R7680:Ctnna3'
ID592713
Institutional Source Beutler Lab
Gene Symbol Ctnna3
Ensembl Gene ENSMUSG00000060843
Gene Namecatenin (cadherin associated protein), alpha 3
SynonymsCatna3, Vr22, alphaT-catenin, 4930429L08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R7680 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location63430098-65003667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64487550 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 488 (H488L)
Ref Sequence ENSEMBL: ENSMUSP00000101081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably benign
Transcript: ENSMUST00000075099
AA Change: H488L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843
AA Change: H488L

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105440
AA Change: H488L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843
AA Change: H488L

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105441
AA Change: H488L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843
AA Change: H488L

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the vinculin/alpha-catenin family. The encoded protein plays a role in cell-cell adhesion in muscle cells. Mutations in this gene are associated with arrhythmogenic right ventricular dysplasia, familial 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased heart weight, increased ventricle size, dilated cardiomyopathy and increased susceptibility to ischemia-induced arrhythmias and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,839,208 D104G possibly damaging Het
Ahi1 G T 10: 21,007,768 C844F possibly damaging Het
AI464131 C A 4: 41,497,978 D551Y probably damaging Het
B230118H07Rik T C 2: 101,610,556 E34G probably damaging Het
Bspry T C 4: 62,496,591 *474Q probably null Het
Car9 T A 4: 43,507,250 D65E probably damaging Het
Ccdc110 T A 8: 45,941,651 M193K possibly damaging Het
Ccdc166 A G 15: 75,981,207 S304P possibly damaging Het
Cdcp1 T C 9: 123,183,519 Q321R probably damaging Het
Cic T C 7: 25,292,431 V2255A probably damaging Het
Cmc2 A T 8: 116,894,110 M44K probably damaging Het
Crls1 A G 2: 132,862,338 T223A probably damaging Het
Cyp2r1 A T 7: 114,552,819 I301N probably damaging Het
Dkk3 A T 7: 112,119,363 L272Q probably damaging Het
Dnah14 A G 1: 181,685,800 N1906S probably benign Het
Gm13271 T C 4: 88,755,130 V88A probably benign Het
Gphn C A 12: 78,412,374 L79I probably benign Het
Gpr15 A T 16: 58,717,965 W254R probably damaging Het
H2-M2 T C 17: 37,483,025 R103G possibly damaging Het
Hcn4 T C 9: 58,860,671 S1172P probably benign Het
Htr1a A G 13: 105,445,031 S260G probably benign Het
Kif21b G T 1: 136,147,869 probably null Het
Lamp1 T C 8: 13,167,812 Y131H probably benign Het
Lrrc47 A C 4: 154,016,101 N378T probably benign Het
Manea A T 4: 26,340,649 H104Q probably damaging Het
Map4k3 A G 17: 80,581,876 I888T probably benign Het
Mark3 T C 12: 111,646,773 M557T probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh6 C A 14: 54,948,733 C1413F possibly damaging Het
Ncr1 T A 7: 4,338,124 M38K possibly damaging Het
Nid2 A G 14: 19,779,647 T669A probably damaging Het
Olfr49 T A 14: 54,282,380 I172F probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekha7 A G 7: 116,164,276 Y364H probably benign Het
Plxnb1 T A 9: 109,100,503 Y142* probably null Het
Ptprn T C 1: 75,247,893 I940V probably benign Het
Rnf213 T C 11: 119,479,556 V4728A Het
Samd9l A T 6: 3,372,569 L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 I264T probably damaging Het
Slc16a7 T C 10: 125,230,936 D278G probably benign Het
Slc35f2 T A 9: 53,808,112 V214E probably damaging Het
Slc7a5 A C 8: 121,907,267 S114A probably damaging Het
St6galnac3 A G 3: 153,205,410 S305P probably damaging Het
Stat1 G A 1: 52,144,209 R378Q probably damaging Het
Tnfrsf9 T G 4: 150,929,938 C31W probably damaging Het
Tnk1 T C 11: 69,856,745 E61G possibly damaging Het
Tnks1bp1 T A 2: 85,059,241 D637E probably benign Het
Ttc17 C T 2: 94,366,544 G486D probably benign Het
Vmn1r30 T A 6: 58,435,299 R183* probably null Het
Vmn2r78 A G 7: 86,954,941 T776A probably damaging Het
Wrap73 A G 4: 154,156,622 E444G probably benign Het
Zc3h13 C T 14: 75,330,515 R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Other mutations in Ctnna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ctnna3 APN 10 63566833 missense probably damaging 1.00
IGL00823:Ctnna3 APN 10 63537543 missense possibly damaging 0.68
IGL00963:Ctnna3 APN 10 64945949 missense probably damaging 1.00
IGL01388:Ctnna3 APN 10 63504107 missense possibly damaging 0.67
IGL01655:Ctnna3 APN 10 64873170 missense probably benign 0.01
IGL01783:Ctnna3 APN 10 63820469 missense possibly damaging 0.91
IGL01909:Ctnna3 APN 10 63504131 missense probably benign 0.11
IGL02160:Ctnna3 APN 10 64250698 missense probably benign
IGL02267:Ctnna3 APN 10 64945998 missense probably benign 0.20
IGL02524:Ctnna3 APN 10 64260826 missense possibly damaging 0.68
IGL02707:Ctnna3 APN 10 63504065 missense probably benign
IGL03165:Ctnna3 APN 10 64945941 missense probably damaging 0.98
Bipolar UTSW 10 64873207 missense probably damaging 0.96
Catatonia UTSW 10 64585995 missense probably benign
hebephrenia UTSW 10 64260935 missense probably benign 0.17
multiple UTSW 10 64250768 missense probably damaging 1.00
PIT4687001:Ctnna3 UTSW 10 64834606 missense probably damaging 1.00
R0345:Ctnna3 UTSW 10 63566840 missense probably benign 0.00
R0387:Ctnna3 UTSW 10 64586130 missense probably benign 0.00
R0523:Ctnna3 UTSW 10 64675909 missense probably damaging 0.97
R0647:Ctnna3 UTSW 10 63820424 missense probably benign 0.00
R0676:Ctnna3 UTSW 10 64409261 missense probably benign 0.20
R1102:Ctnna3 UTSW 10 64585995 missense probably benign
R1521:Ctnna3 UTSW 10 64959842 missense probably benign 0.22
R1700:Ctnna3 UTSW 10 63852772 missense probably damaging 1.00
R1874:Ctnna3 UTSW 10 63504107 missense possibly damaging 0.67
R1995:Ctnna3 UTSW 10 63820364 missense probably damaging 0.98
R2088:Ctnna3 UTSW 10 64873207 missense probably damaging 0.96
R2198:Ctnna3 UTSW 10 65002745 missense probably benign 0.00
R4056:Ctnna3 UTSW 10 65002568 missense probably damaging 1.00
R4208:Ctnna3 UTSW 10 64959778 missense probably benign 0.22
R4440:Ctnna3 UTSW 10 64260935 missense probably benign 0.17
R4568:Ctnna3 UTSW 10 63852809 missense possibly damaging 0.56
R4594:Ctnna3 UTSW 10 64586079 missense probably benign 0.32
R4835:Ctnna3 UTSW 10 63581944 missense probably benign 0.01
R4849:Ctnna3 UTSW 10 64873315 missense probably damaging 1.00
R5682:Ctnna3 UTSW 10 64873306 missense probably damaging 0.96
R5777:Ctnna3 UTSW 10 64675885 missense probably benign
R6414:Ctnna3 UTSW 10 64260865 missense probably benign 0.35
R7210:Ctnna3 UTSW 10 64250768 missense probably damaging 1.00
R7220:Ctnna3 UTSW 10 64834589 missense probably benign 0.04
R7934:Ctnna3 UTSW 10 64585968 missense probably damaging 1.00
R8006:Ctnna3 UTSW 10 63582011 missense probably benign 0.02
R8272:Ctnna3 UTSW 10 65002598 missense probably damaging 1.00
R8415:Ctnna3 UTSW 10 63504130 missense probably benign 0.05
Z1088:Ctnna3 UTSW 10 63581978 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAAGAGTACCTGCAGTCTGC -3'
(R):5'- AGTAATGCATTTCCACACTCCC -3'

Sequencing Primer
(F):5'- CTGCATATTGGCTTTTGTTTTCAACG -3'
(R):5'- CTACATATGGACCATAGCATGTGCAG -3'
Posted On2019-11-12