Incidental Mutation 'R7680:Htr1a'
ID592719
Institutional Source Beutler Lab
Gene Symbol Htr1a
Ensembl Gene ENSMUSG00000021721
Gene Name5-hydroxytryptamine (serotonin) receptor 1A
Synonyms5-HT1A receptor, Gpcr18
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7680 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location105443639-105448122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105445031 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 260 (S260G)
Ref Sequence ENSEMBL: ENSMUSP00000022235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022235]
Predicted Effect probably benign
Transcript: ENSMUST00000022235
AA Change: S260G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022235
Gene: ENSMUSG00000021721
AA Change: S260G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 45 174 2.7e-5 PFAM
Pfam:7TM_GPCR_Srsx 47 236 8e-8 PFAM
Pfam:7tm_1 53 400 1.3e-88 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygotes for targeted null mutations show a common phenotype, including augmented anxious-like behavior in the elevated plus-maze, open-field, and novel object tests, reduced immobility in the forced-swim or tail-suspension test, and changes in density of 5-HTT binding in several brain regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,839,208 D104G possibly damaging Het
Ahi1 G T 10: 21,007,768 C844F possibly damaging Het
AI464131 C A 4: 41,497,978 D551Y probably damaging Het
B230118H07Rik T C 2: 101,610,556 E34G probably damaging Het
Bspry T C 4: 62,496,591 *474Q probably null Het
Car9 T A 4: 43,507,250 D65E probably damaging Het
Ccdc110 T A 8: 45,941,651 M193K possibly damaging Het
Ccdc166 A G 15: 75,981,207 S304P possibly damaging Het
Cdcp1 T C 9: 123,183,519 Q321R probably damaging Het
Cic T C 7: 25,292,431 V2255A probably damaging Het
Cmc2 A T 8: 116,894,110 M44K probably damaging Het
Crls1 A G 2: 132,862,338 T223A probably damaging Het
Ctnna3 A T 10: 64,487,550 H488L probably benign Het
Cyp2r1 A T 7: 114,552,819 I301N probably damaging Het
Dkk3 A T 7: 112,119,363 L272Q probably damaging Het
Dnah14 A G 1: 181,685,800 N1906S probably benign Het
Gm13271 T C 4: 88,755,130 V88A probably benign Het
Gphn C A 12: 78,412,374 L79I probably benign Het
Gpr15 A T 16: 58,717,965 W254R probably damaging Het
H2-M2 T C 17: 37,483,025 R103G possibly damaging Het
Hcn4 T C 9: 58,860,671 S1172P probably benign Het
Kif21b G T 1: 136,147,869 probably null Het
Lamp1 T C 8: 13,167,812 Y131H probably benign Het
Lrrc47 A C 4: 154,016,101 N378T probably benign Het
Manea A T 4: 26,340,649 H104Q probably damaging Het
Map4k3 A G 17: 80,581,876 I888T probably benign Het
Mark3 T C 12: 111,646,773 M557T probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh6 C A 14: 54,948,733 C1413F possibly damaging Het
Ncr1 T A 7: 4,338,124 M38K possibly damaging Het
Nid2 A G 14: 19,779,647 T669A probably damaging Het
Olfr49 T A 14: 54,282,380 I172F probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekha7 A G 7: 116,164,276 Y364H probably benign Het
Plxnb1 T A 9: 109,100,503 Y142* probably null Het
Ptprn T C 1: 75,247,893 I940V probably benign Het
Rnf213 T C 11: 119,479,556 V4728A Het
Samd9l A T 6: 3,372,569 L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 I264T probably damaging Het
Slc16a7 T C 10: 125,230,936 D278G probably benign Het
Slc35f2 T A 9: 53,808,112 V214E probably damaging Het
Slc7a5 A C 8: 121,907,267 S114A probably damaging Het
St6galnac3 A G 3: 153,205,410 S305P probably damaging Het
Stat1 G A 1: 52,144,209 R378Q probably damaging Het
Tnfrsf9 T G 4: 150,929,938 C31W probably damaging Het
Tnk1 T C 11: 69,856,745 E61G possibly damaging Het
Tnks1bp1 T A 2: 85,059,241 D637E probably benign Het
Ttc17 C T 2: 94,366,544 G486D probably benign Het
Vmn1r30 T A 6: 58,435,299 R183* probably null Het
Vmn2r78 A G 7: 86,954,941 T776A probably damaging Het
Wrap73 A G 4: 154,156,622 E444G probably benign Het
Zc3h13 C T 14: 75,330,515 R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Other mutations in Htr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Htr1a APN 13 105445284 missense possibly damaging 0.88
R0578:Htr1a UTSW 13 105445087 missense probably damaging 1.00
R0919:Htr1a UTSW 13 105444836 missense probably damaging 1.00
R0962:Htr1a UTSW 13 105444324 missense probably benign 0.02
R1143:Htr1a UTSW 13 105445068 missense probably benign
R1349:Htr1a UTSW 13 105445366 nonsense probably null
R1550:Htr1a UTSW 13 105445280 missense probably benign 0.09
R2520:Htr1a UTSW 13 105445373 missense probably benign 0.43
R3794:Htr1a UTSW 13 105444344 missense possibly damaging 0.59
R6679:Htr1a UTSW 13 105445428 missense probably damaging 1.00
R6844:Htr1a UTSW 13 105444947 missense possibly damaging 0.94
Z1177:Htr1a UTSW 13 105444876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGGTACACCATCTACTCC -3'
(R):5'- CAAGGCCATCTTGCGCTTTG -3'

Sequencing Primer
(F):5'- GGTACACCATCTACTCCACTTTCGG -3'
(R):5'- TTTTCTCTCCAAGCAGGCGGG -3'
Posted On2019-11-12