Incidental Mutation 'R7680:Map4k3'
ID592728
Institutional Source Beutler Lab
Gene Symbol Map4k3
Ensembl Gene ENSMUSG00000024242
Gene Namemitogen-activated protein kinase kinase kinase kinase 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7680 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location80580512-80728093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80581876 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 888 (I888T)
Ref Sequence ENSEMBL: ENSMUSP00000108008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025089] [ENSMUST00000112389]
Predicted Effect probably benign
Transcript: ENSMUST00000025089
AA Change: I886T

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025089
Gene: ENSMUSG00000024242
AA Change: I886T

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 874 2e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112389
AA Change: I888T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108008
Gene: ENSMUSG00000024242
AA Change: I888T

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 876 1.39e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,839,208 D104G possibly damaging Het
Ahi1 G T 10: 21,007,768 C844F possibly damaging Het
AI464131 C A 4: 41,497,978 D551Y probably damaging Het
B230118H07Rik T C 2: 101,610,556 E34G probably damaging Het
Bspry T C 4: 62,496,591 *474Q probably null Het
Car9 T A 4: 43,507,250 D65E probably damaging Het
Ccdc110 T A 8: 45,941,651 M193K possibly damaging Het
Ccdc166 A G 15: 75,981,207 S304P possibly damaging Het
Cdcp1 T C 9: 123,183,519 Q321R probably damaging Het
Cic T C 7: 25,292,431 V2255A probably damaging Het
Cmc2 A T 8: 116,894,110 M44K probably damaging Het
Crls1 A G 2: 132,862,338 T223A probably damaging Het
Ctnna3 A T 10: 64,487,550 H488L probably benign Het
Cyp2r1 A T 7: 114,552,819 I301N probably damaging Het
Dkk3 A T 7: 112,119,363 L272Q probably damaging Het
Dnah14 A G 1: 181,685,800 N1906S probably benign Het
Gm13271 T C 4: 88,755,130 V88A probably benign Het
Gphn C A 12: 78,412,374 L79I probably benign Het
Gpr15 A T 16: 58,717,965 W254R probably damaging Het
H2-M2 T C 17: 37,483,025 R103G possibly damaging Het
Hcn4 T C 9: 58,860,671 S1172P probably benign Het
Htr1a A G 13: 105,445,031 S260G probably benign Het
Kif21b G T 1: 136,147,869 probably null Het
Lamp1 T C 8: 13,167,812 Y131H probably benign Het
Lrrc47 A C 4: 154,016,101 N378T probably benign Het
Manea A T 4: 26,340,649 H104Q probably damaging Het
Mark3 T C 12: 111,646,773 M557T probably benign Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Myh6 C A 14: 54,948,733 C1413F possibly damaging Het
Ncr1 T A 7: 4,338,124 M38K possibly damaging Het
Nid2 A G 14: 19,779,647 T669A probably damaging Het
Olfr49 T A 14: 54,282,380 I172F probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekha7 A G 7: 116,164,276 Y364H probably benign Het
Plxnb1 T A 9: 109,100,503 Y142* probably null Het
Ptprn T C 1: 75,247,893 I940V probably benign Het
Rnf213 T C 11: 119,479,556 V4728A Het
Samd9l A T 6: 3,372,569 L1564Q probably damaging Het
Samd9l A G 6: 3,376,469 I264T probably damaging Het
Slc16a7 T C 10: 125,230,936 D278G probably benign Het
Slc35f2 T A 9: 53,808,112 V214E probably damaging Het
Slc7a5 A C 8: 121,907,267 S114A probably damaging Het
St6galnac3 A G 3: 153,205,410 S305P probably damaging Het
Stat1 G A 1: 52,144,209 R378Q probably damaging Het
Tnfrsf9 T G 4: 150,929,938 C31W probably damaging Het
Tnk1 T C 11: 69,856,745 E61G possibly damaging Het
Tnks1bp1 T A 2: 85,059,241 D637E probably benign Het
Ttc17 C T 2: 94,366,544 G486D probably benign Het
Vmn1r30 T A 6: 58,435,299 R183* probably null Het
Vmn2r78 A G 7: 86,954,941 T776A probably damaging Het
Wrap73 A G 4: 154,156,622 E444G probably benign Het
Zc3h13 C T 14: 75,330,515 R1083C probably damaging Het
Zfp189 A G 4: 49,521,547 probably benign Het
Other mutations in Map4k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Map4k3 APN 17 80636718 critical splice donor site probably null
IGL01329:Map4k3 APN 17 80644184 missense probably benign
IGL01626:Map4k3 APN 17 80605809 missense probably damaging 0.97
IGL01896:Map4k3 APN 17 80613931 missense probably benign 0.13
IGL02021:Map4k3 APN 17 80609826 missense probably damaging 1.00
IGL02585:Map4k3 APN 17 80653919 splice site probably benign
IGL03101:Map4k3 APN 17 80655855 critical splice donor site probably null
IGL03231:Map4k3 APN 17 80597675 missense probably damaging 1.00
IGL03267:Map4k3 APN 17 80664028 missense probably damaging 1.00
maple_forest UTSW 17 80603998 missense probably benign 0.38
R0084:Map4k3 UTSW 17 80655914 missense possibly damaging 0.91
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0612:Map4k3 UTSW 17 80602193 missense probably damaging 1.00
R0842:Map4k3 UTSW 17 80605983 missense probably benign 0.35
R2009:Map4k3 UTSW 17 80664088 splice site probably benign
R2224:Map4k3 UTSW 17 80630454 missense probably benign 0.00
R3851:Map4k3 UTSW 17 80644323 splice site probably benign
R4049:Map4k3 UTSW 17 80605965 missense probably benign 0.10
R4151:Map4k3 UTSW 17 80644534 missense probably damaging 1.00
R4345:Map4k3 UTSW 17 80597551 critical splice donor site probably null
R4405:Map4k3 UTSW 17 80615015 critical splice donor site probably null
R4450:Map4k3 UTSW 17 80603982 critical splice donor site probably null
R4970:Map4k3 UTSW 17 80653903 missense probably benign 0.00
R5230:Map4k3 UTSW 17 80615170 missense probably benign 0.00
R5459:Map4k3 UTSW 17 80609787 missense probably damaging 1.00
R5568:Map4k3 UTSW 17 80663998 missense possibly damaging 0.96
R5635:Map4k3 UTSW 17 80613495 missense possibly damaging 0.94
R5827:Map4k3 UTSW 17 80593283 critical splice donor site probably null
R5927:Map4k3 UTSW 17 80613919 missense probably benign 0.06
R5951:Map4k3 UTSW 17 80603998 missense probably benign 0.38
R5964:Map4k3 UTSW 17 80644762 missense probably damaging 1.00
R6849:Map4k3 UTSW 17 80630413 critical splice donor site probably null
R6985:Map4k3 UTSW 17 80636732 missense probably damaging 1.00
R7040:Map4k3 UTSW 17 80680915 missense probably damaging 0.98
R7233:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7511:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7672:Map4k3 UTSW 17 80615071 missense possibly damaging 0.58
R7804:Map4k3 UTSW 17 80615070 missense probably damaging 0.98
X0023:Map4k3 UTSW 17 80593091 missense probably benign
Z1176:Map4k3 UTSW 17 80618337 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCACTTGTGTGGTTCAATATGC -3'
(R):5'- GCAGTGCTTAGAGTAGTGTCTAAAAG -3'

Sequencing Primer
(F):5'- AAAACAAAATGTTCTCCCATCTGTC -3'
(R):5'- TAGTGTCTAAAAGAAGCCATGGTTG -3'
Posted On2019-11-12