Incidental Mutation 'R7681:Fam135a'
ID592730
Institutional Source Beutler Lab
Gene Symbol Fam135a
Ensembl Gene ENSMUSG00000026153
Gene Namefamily with sequence similarity 135, member A
Synonyms4921533L14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7681 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location24011093-24100341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24067915 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 47 (S47R)
Ref Sequence ENSEMBL: ENSMUSP00000027337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027337] [ENSMUST00000186999] [ENSMUST00000187369] [ENSMUST00000187752] [ENSMUST00000188712]
Predicted Effect probably benign
Transcript: ENSMUST00000027337
AA Change: S47R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027337
Gene: ENSMUSG00000026153
AA Change: S47R

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
coiled coil region 270 295 N/A INTRINSIC
low complexity region 489 502 N/A INTRINSIC
low complexity region 842 853 N/A INTRINSIC
low complexity region 1072 1085 N/A INTRINSIC
Blast:LRRNT 1139 1172 4e-6 BLAST
low complexity region 1173 1184 N/A INTRINSIC
Pfam:DUF676 1235 1431 9e-65 PFAM
Pfam:PGAP1 1237 1440 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186999
AA Change: S47R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140198
Gene: ENSMUSG00000026153
AA Change: S47R

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 1.8e-15 PFAM
Pfam:DUF3657 338 395 7.3e-8 PFAM
low complexity region 672 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187369
AA Change: S47R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140766
Gene: ENSMUSG00000026153
AA Change: S47R

DomainStartEndE-ValueType
Pfam:DUF3657 111 173 3e-15 PFAM
coiled coil region 270 295 N/A INTRINSIC
Pfam:DUF3657 312 369 1.2e-7 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Blast:LRRNT 943 976 4e-6 BLAST
low complexity region 977 988 N/A INTRINSIC
Pfam:DUF676 1039 1235 6.8e-62 PFAM
Pfam:PGAP1 1041 1259 8.1e-5 PFAM
Pfam:LCAT 1097 1203 2.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187752
SMART Domains Protein: ENSMUSP00000139633
Gene: ENSMUSG00000026153

DomainStartEndE-ValueType
Pfam:DUF3657 68 130 3e-15 PFAM
Pfam:DUF3657 295 352 1.2e-7 PFAM
low complexity region 629 640 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Blast:LRRNT 926 959 4e-6 BLAST
low complexity region 960 971 N/A INTRINSIC
Pfam:DUF676 1022 1218 6.7e-62 PFAM
Pfam:PGAP1 1024 1242 8e-5 PFAM
Pfam:LCAT 1080 1186 2.2e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188712
AA Change: S47R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,849,619 A963V probably benign Het
Agbl1 T C 7: 76,444,901 V760A unknown Het
Akap13 T C 7: 75,728,796 F347L possibly damaging Het
Anapc5 A T 5: 122,802,139 F356L probably benign Het
Bmp6 A G 13: 38,346,195 H88R probably damaging Het
Cblb C A 16: 52,204,638 S921R probably damaging Het
Ccs T A 19: 4,832,830 probably null Het
Cyp20a1 A G 1: 60,353,033 T83A probably benign Het
Defa25 T A 8: 21,084,519 D26E probably benign Het
Dmwd T A 7: 19,081,082 N552K probably benign Het
Dnah17 C T 11: 118,025,186 V4297M probably damaging Het
Fbxo41 A T 6: 85,478,479 C574* probably null Het
Fgb T C 3: 83,049,832 probably benign Het
Fgfr1 C T 8: 25,555,661 T82I probably damaging Het
Fhod3 T A 18: 24,990,038 L262M probably damaging Het
Galnt16 A T 12: 80,590,639 Q380L probably damaging Het
Glp2r C T 11: 67,709,679 G448D probably benign Het
Gm8765 C T 13: 50,702,254 P643S possibly damaging Het
Gnb4 C A 3: 32,587,753 A242S possibly damaging Het
Golim4 T C 3: 75,887,024 probably null Het
Grik2 G T 10: 49,244,380 N604K probably damaging Het
Hnf1b T G 11: 83,889,146 I435S probably damaging Het
Hoxa11 C T 6: 52,245,119 G201S probably benign Het
Hpse A G 5: 100,691,391 S364P possibly damaging Het
Kif16b A T 2: 142,756,126 N525K probably damaging Het
Kif1a A T 1: 93,054,944 C704S probably benign Het
Limk2 A G 11: 3,353,354 S322P probably damaging Het
Lrp1b A T 2: 40,874,999 C2938* probably null Het
Malrd1 A G 2: 16,218,102 R2071G unknown Het
Man2a2 T A 7: 80,351,749 I1137F possibly damaging Het
Map2k6 C T 11: 110,497,903 R224* probably null Het
Map3k4 G A 17: 12,318,543 P29L unknown Het
Morn5 A T 2: 36,057,144 N145Y possibly damaging Het
Muc20 T C 16: 32,793,619 T463A probably benign Het
Myh10 C T 11: 68,771,936 T642I probably damaging Het
Myh14 C A 7: 44,624,148 R1362L possibly damaging Het
Nup88 C A 11: 70,969,885 V23L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1221 A C 2: 89,111,591 V307G probably benign Het
Olfr1340 A G 4: 118,726,564 I106V probably benign Het
Olfr477 T C 7: 107,991,148 M261T possibly damaging Het
Pabpn1 T C 14: 54,898,042 Y299H probably damaging Het
Pak4 T C 7: 28,560,230 E514G probably damaging Het
Ppp1r12b A C 1: 134,865,935 S564A probably benign Het
Psmc2 T C 5: 21,803,274 probably null Het
Psme4 A G 11: 30,791,975 Y146C possibly damaging Het
Rb1cc1 A G 1: 6,240,323 D315G probably damaging Het
Rilpl1 A G 5: 124,530,913 V24A possibly damaging Het
Rtel1 A T 2: 181,322,394 H62L probably damaging Het
Ruvbl1 G A 6: 88,467,653 probably null Het
Scn5a A G 9: 119,529,977 V668A probably benign Het
Slc22a6 G A 19: 8,626,129 G519E probably benign Het
Slc43a2 T A 11: 75,563,673 I348N probably benign Het
Slc6a16 T A 7: 45,260,914 L347Q probably damaging Het
Smg6 T A 11: 74,931,705 L658H probably damaging Het
Spidr C A 16: 15,895,624 G832W probably damaging Het
Ssrp1 G A 2: 85,045,748 G616E probably benign Het
Sult1b1 G A 5: 87,530,636 L110F probably damaging Het
Tfec T A 6: 16,834,236 H224L probably benign Het
Ttn C T 2: 76,708,951 E34564K probably benign Het
Washc2 A G 6: 116,260,657 D1285G probably damaging Het
Zfp870 T C 17: 32,882,690 E555G probably benign Het
Other mutations in Fam135a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Fam135a APN 1 24055898 missense probably damaging 1.00
IGL01993:Fam135a APN 1 24055911 missense probably damaging 0.99
IGL02172:Fam135a APN 1 24024780 critical splice donor site probably null
IGL02832:Fam135a APN 1 24028633 missense probably benign 0.00
IGL03075:Fam135a APN 1 24030906 splice site probably benign
IGL03197:Fam135a APN 1 24044182 missense probably damaging 1.00
IGL03214:Fam135a APN 1 24053276 missense probably damaging 1.00
IGL03355:Fam135a APN 1 24029168 missense possibly damaging 0.93
PIT4434001:Fam135a UTSW 1 24029195 missense probably benign
R0276:Fam135a UTSW 1 24067964 missense probably damaging 1.00
R1429:Fam135a UTSW 1 24044267 missense probably damaging 1.00
R1553:Fam135a UTSW 1 24021870 missense probably damaging 0.97
R1582:Fam135a UTSW 1 24029317 missense probably damaging 1.00
R1686:Fam135a UTSW 1 24029806 missense probably benign 0.05
R1732:Fam135a UTSW 1 24026653 missense possibly damaging 0.71
R1859:Fam135a UTSW 1 24030225 missense probably damaging 1.00
R1954:Fam135a UTSW 1 24029602 missense probably damaging 1.00
R2266:Fam135a UTSW 1 24028797 missense probably benign 0.22
R2570:Fam135a UTSW 1 24021964 missense probably damaging 1.00
R3725:Fam135a UTSW 1 24057434 nonsense probably null
R3740:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3741:Fam135a UTSW 1 24014811 missense probably damaging 0.99
R3765:Fam135a UTSW 1 24055877 missense possibly damaging 0.95
R3792:Fam135a UTSW 1 24028311 missense probably benign 0.14
R3940:Fam135a UTSW 1 24057475 missense probably damaging 0.98
R3946:Fam135a UTSW 1 24030394 missense probably damaging 0.96
R4754:Fam135a UTSW 1 24028754 nonsense probably null
R4794:Fam135a UTSW 1 24029160 missense probably benign 0.36
R4887:Fam135a UTSW 1 24024253 nonsense probably null
R4891:Fam135a UTSW 1 24030328 missense probably benign 0.00
R4929:Fam135a UTSW 1 24030000 missense probably benign 0.16
R4999:Fam135a UTSW 1 24020677 missense possibly damaging 0.83
R5092:Fam135a UTSW 1 24028807 missense probably benign 0.11
R5205:Fam135a UTSW 1 24029511 missense probably benign 0.05
R5313:Fam135a UTSW 1 24028585 missense possibly damaging 0.89
R5579:Fam135a UTSW 1 24029727 missense possibly damaging 0.93
R5689:Fam135a UTSW 1 24029053 missense probably benign 0.22
R5863:Fam135a UTSW 1 24014782 missense possibly damaging 0.94
R5869:Fam135a UTSW 1 24029430 missense possibly damaging 0.53
R6128:Fam135a UTSW 1 24030740 critical splice donor site probably null
R6505:Fam135a UTSW 1 24014872 missense probably damaging 1.00
R6668:Fam135a UTSW 1 24028848 missense probably damaging 0.99
R6793:Fam135a UTSW 1 24067925 missense possibly damaging 0.69
R6857:Fam135a UTSW 1 24014789 missense probably damaging 0.99
R6931:Fam135a UTSW 1 24085487 start codon destroyed probably damaging 1.00
R6977:Fam135a UTSW 1 24054098 missense probably damaging 1.00
R7187:Fam135a UTSW 1 24044214 missense probably damaging 1.00
R7206:Fam135a UTSW 1 24030273 missense probably benign 0.14
R7305:Fam135a UTSW 1 24030858 missense probably damaging 1.00
R7313:Fam135a UTSW 1 24057392 missense probably damaging 0.98
R7420:Fam135a UTSW 1 24012486 missense possibly damaging 0.68
R7646:Fam135a UTSW 1 24028623 missense probably benign 0.06
R7661:Fam135a UTSW 1 24072762 intron probably null
R7748:Fam135a UTSW 1 24028969 missense probably benign 0.00
R7845:Fam135a UTSW 1 24029657 missense probably benign 0.27
R7849:Fam135a UTSW 1 24044250 missense probably damaging 1.00
R7914:Fam135a UTSW 1 24026679 missense probably damaging 1.00
R8314:Fam135a UTSW 1 24021921 missense possibly damaging 0.84
X0022:Fam135a UTSW 1 24030214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCAAATTAAGCCCGTTTGACTG -3'
(R):5'- CTGTACATGTGCCAAATCTCTC -3'

Sequencing Primer
(F):5'- CCCGTTTGACTGATTTCTTAAAAGGG -3'
(R):5'- TCATAGGTGGATATGGGAAATGTTAC -3'
Posted On2019-11-12