Incidental Mutation 'R7681:Rilpl1'
ID592751
Institutional Source Beutler Lab
Gene Symbol Rilpl1
Ensembl Gene ENSMUSG00000029392
Gene NameRab interacting lysosomal protein-like 1
Synonyms2900002H16Rik, 6330559I19Rik, GOSPEL
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7681 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location124493080-124531391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124530913 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 24 (V24A)
Ref Sequence ENSEMBL: ENSMUSP00000050014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062153]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062153
AA Change: V24A

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050014
Gene: ENSMUSG00000029392
AA Change: V24A

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 27 175 2.3e-47 PFAM
Pfam:RILP 298 351 4e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,849,619 A963V probably benign Het
Agbl1 T C 7: 76,444,901 V760A unknown Het
Akap13 T C 7: 75,728,796 F347L possibly damaging Het
Anapc5 A T 5: 122,802,139 F356L probably benign Het
Bmp6 A G 13: 38,346,195 H88R probably damaging Het
Cblb C A 16: 52,204,638 S921R probably damaging Het
Ccs T A 19: 4,832,830 probably null Het
Cyp20a1 A G 1: 60,353,033 T83A probably benign Het
Defa25 T A 8: 21,084,519 D26E probably benign Het
Dmwd T A 7: 19,081,082 N552K probably benign Het
Dnah17 C T 11: 118,025,186 V4297M probably damaging Het
Fam135a A T 1: 24,067,915 S47R probably benign Het
Fbxo41 A T 6: 85,478,479 C574* probably null Het
Fgb T C 3: 83,049,832 probably benign Het
Fgfr1 C T 8: 25,555,661 T82I probably damaging Het
Fhod3 T A 18: 24,990,038 L262M probably damaging Het
Galnt16 A T 12: 80,590,639 Q380L probably damaging Het
Glp2r C T 11: 67,709,679 G448D probably benign Het
Gm8765 C T 13: 50,702,254 P643S possibly damaging Het
Gnb4 C A 3: 32,587,753 A242S possibly damaging Het
Golim4 T C 3: 75,887,024 probably null Het
Grik2 G T 10: 49,244,380 N604K probably damaging Het
Hnf1b T G 11: 83,889,146 I435S probably damaging Het
Hoxa11 C T 6: 52,245,119 G201S probably benign Het
Hpse A G 5: 100,691,391 S364P possibly damaging Het
Kif16b A T 2: 142,756,126 N525K probably damaging Het
Kif1a A T 1: 93,054,944 C704S probably benign Het
Limk2 A G 11: 3,353,354 S322P probably damaging Het
Lrp1b A T 2: 40,874,999 C2938* probably null Het
Malrd1 A G 2: 16,218,102 R2071G unknown Het
Man2a2 T A 7: 80,351,749 I1137F possibly damaging Het
Map2k6 C T 11: 110,497,903 R224* probably null Het
Map3k4 G A 17: 12,318,543 P29L unknown Het
Morn5 A T 2: 36,057,144 N145Y possibly damaging Het
Muc20 T C 16: 32,793,619 T463A probably benign Het
Myh10 C T 11: 68,771,936 T642I probably damaging Het
Myh14 C A 7: 44,624,148 R1362L possibly damaging Het
Nup88 C A 11: 70,969,885 V23L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1221 A C 2: 89,111,591 V307G probably benign Het
Olfr1340 A G 4: 118,726,564 I106V probably benign Het
Olfr477 T C 7: 107,991,148 M261T possibly damaging Het
Pabpn1 T C 14: 54,898,042 Y299H probably damaging Het
Pak4 T C 7: 28,560,230 E514G probably damaging Het
Ppp1r12b A C 1: 134,865,935 S564A probably benign Het
Psmc2 T C 5: 21,803,274 probably null Het
Psme4 A G 11: 30,791,975 Y146C possibly damaging Het
Rb1cc1 A G 1: 6,240,323 D315G probably damaging Het
Rtel1 A T 2: 181,322,394 H62L probably damaging Het
Ruvbl1 G A 6: 88,467,653 probably null Het
Scn5a A G 9: 119,529,977 V668A probably benign Het
Slc22a6 G A 19: 8,626,129 G519E probably benign Het
Slc43a2 T A 11: 75,563,673 I348N probably benign Het
Slc6a16 T A 7: 45,260,914 L347Q probably damaging Het
Smg6 T A 11: 74,931,705 L658H probably damaging Het
Spidr C A 16: 15,895,624 G832W probably damaging Het
Ssrp1 G A 2: 85,045,748 G616E probably benign Het
Sult1b1 G A 5: 87,530,636 L110F probably damaging Het
Tfec T A 6: 16,834,236 H224L probably benign Het
Ttn C T 2: 76,708,951 E34564K probably benign Het
Washc2 A G 6: 116,260,657 D1285G probably damaging Het
Zfp870 T C 17: 32,882,690 E555G probably benign Het
Other mutations in Rilpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Rilpl1 APN 5 124503649 missense probably damaging 1.00
IGL01727:Rilpl1 APN 5 124530944 missense possibly damaging 0.50
R0973:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0973:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R0973:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0973:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R0974:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0974:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R1056:Rilpl1 UTSW 5 124493837 missense probably damaging 1.00
R1539:Rilpl1 UTSW 5 124515555 missense probably damaging 1.00
R1800:Rilpl1 UTSW 5 124514656 missense probably damaging 1.00
R1928:Rilpl1 UTSW 5 124514750 unclassified probably benign
R4661:Rilpl1 UTSW 5 124514688 missense probably benign 0.32
R4804:Rilpl1 UTSW 5 124493765 missense probably damaging 1.00
R4904:Rilpl1 UTSW 5 124514744 unclassified probably null
R4937:Rilpl1 UTSW 5 124515531 missense possibly damaging 0.64
R5034:Rilpl1 UTSW 5 124493824 missense probably damaging 1.00
R6301:Rilpl1 UTSW 5 124514539 missense probably damaging 1.00
R7009:Rilpl1 UTSW 5 124503692 synonymous silent
Predicted Primers PCR Primer
(F):5'- AATGCGGTCCATCCTCTCTACG -3'
(R):5'- AGTTGGAGCATCAAGTCCG -3'

Sequencing Primer
(F):5'- AACCGGTCCAGTTCCAGG -3'
(R):5'- GTTCACGAGTTACTGGAG -3'
Posted On2019-11-12