Incidental Mutation 'R7681:Pak4'
ID592758
Institutional Source Beutler Lab
Gene Symbol Pak4
Ensembl Gene ENSMUSG00000030602
Gene Namep21 (RAC1) activated kinase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7681 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28558819-28598185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28560230 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 514 (E514G)
Ref Sequence ENSEMBL: ENSMUSP00000032823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032823] [ENSMUST00000040531] [ENSMUST00000108283]
Predicted Effect probably damaging
Transcript: ENSMUST00000032823
AA Change: E514G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032823
Gene: ENSMUSG00000030602
AA Change: E514G

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108283
AA Change: E514G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103918
Gene: ENSMUSG00000030602
AA Change: E514G

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die at midgestation exhibiting heart defects as well as impaired neuronal development and yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,849,619 A963V probably benign Het
Agbl1 T C 7: 76,444,901 V760A unknown Het
Akap13 T C 7: 75,728,796 F347L possibly damaging Het
Anapc5 A T 5: 122,802,139 F356L probably benign Het
Bmp6 A G 13: 38,346,195 H88R probably damaging Het
Cblb C A 16: 52,204,638 S921R probably damaging Het
Ccs T A 19: 4,832,830 probably null Het
Cyp20a1 A G 1: 60,353,033 T83A probably benign Het
Defa25 T A 8: 21,084,519 D26E probably benign Het
Dmwd T A 7: 19,081,082 N552K probably benign Het
Dnah17 C T 11: 118,025,186 V4297M probably damaging Het
Fam135a A T 1: 24,067,915 S47R probably benign Het
Fbxo41 A T 6: 85,478,479 C574* probably null Het
Fgb T C 3: 83,049,832 probably benign Het
Fgfr1 C T 8: 25,555,661 T82I probably damaging Het
Fhod3 T A 18: 24,990,038 L262M probably damaging Het
Galnt16 A T 12: 80,590,639 Q380L probably damaging Het
Glp2r C T 11: 67,709,679 G448D probably benign Het
Gm8765 C T 13: 50,702,254 P643S possibly damaging Het
Gnb4 C A 3: 32,587,753 A242S possibly damaging Het
Golim4 T C 3: 75,887,024 probably null Het
Grik2 G T 10: 49,244,380 N604K probably damaging Het
Hnf1b T G 11: 83,889,146 I435S probably damaging Het
Hoxa11 C T 6: 52,245,119 G201S probably benign Het
Hpse A G 5: 100,691,391 S364P possibly damaging Het
Kif16b A T 2: 142,756,126 N525K probably damaging Het
Kif1a A T 1: 93,054,944 C704S probably benign Het
Limk2 A G 11: 3,353,354 S322P probably damaging Het
Lrp1b A T 2: 40,874,999 C2938* probably null Het
Malrd1 A G 2: 16,218,102 R2071G unknown Het
Man2a2 T A 7: 80,351,749 I1137F possibly damaging Het
Map2k6 C T 11: 110,497,903 R224* probably null Het
Map3k4 G A 17: 12,318,543 P29L unknown Het
Morn5 A T 2: 36,057,144 N145Y possibly damaging Het
Muc20 T C 16: 32,793,619 T463A probably benign Het
Myh10 C T 11: 68,771,936 T642I probably damaging Het
Myh14 C A 7: 44,624,148 R1362L possibly damaging Het
Nup88 C A 11: 70,969,885 V23L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1221 A C 2: 89,111,591 V307G probably benign Het
Olfr1340 A G 4: 118,726,564 I106V probably benign Het
Olfr477 T C 7: 107,991,148 M261T possibly damaging Het
Pabpn1 T C 14: 54,898,042 Y299H probably damaging Het
Ppp1r12b A C 1: 134,865,935 S564A probably benign Het
Psmc2 T C 5: 21,803,274 probably null Het
Psme4 A G 11: 30,791,975 Y146C possibly damaging Het
Rb1cc1 A G 1: 6,240,323 D315G probably damaging Het
Rilpl1 A G 5: 124,530,913 V24A possibly damaging Het
Rtel1 A T 2: 181,322,394 H62L probably damaging Het
Ruvbl1 G A 6: 88,467,653 probably null Het
Scn5a A G 9: 119,529,977 V668A probably benign Het
Slc22a6 G A 19: 8,626,129 G519E probably benign Het
Slc43a2 T A 11: 75,563,673 I348N probably benign Het
Slc6a16 T A 7: 45,260,914 L347Q probably damaging Het
Smg6 T A 11: 74,931,705 L658H probably damaging Het
Spidr C A 16: 15,895,624 G832W probably damaging Het
Ssrp1 G A 2: 85,045,748 G616E probably benign Het
Sult1b1 G A 5: 87,530,636 L110F probably damaging Het
Tfec T A 6: 16,834,236 H224L probably benign Het
Ttn C T 2: 76,708,951 E34564K probably benign Het
Washc2 A G 6: 116,260,657 D1285G probably damaging Het
Zfp870 T C 17: 32,882,690 E555G probably benign Het
Other mutations in Pak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0025:Pak4 UTSW 7 28564283 missense probably damaging 1.00
R0531:Pak4 UTSW 7 28568054 missense possibly damaging 0.69
R0893:Pak4 UTSW 7 28559777 missense probably benign 0.21
R1108:Pak4 UTSW 7 28560242 missense probably damaging 1.00
R1801:Pak4 UTSW 7 28565190 missense probably damaging 1.00
R1844:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R3108:Pak4 UTSW 7 28564344 nonsense probably null
R4693:Pak4 UTSW 7 28564249 missense probably damaging 1.00
R5320:Pak4 UTSW 7 28568206 missense probably damaging 0.98
R5357:Pak4 UTSW 7 28564406 missense probably damaging 0.99
R5724:Pak4 UTSW 7 28564580 missense possibly damaging 0.94
R6047:Pak4 UTSW 7 28563036 missense probably benign 0.34
R6161:Pak4 UTSW 7 28565267 missense possibly damaging 0.95
R6241:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R6820:Pak4 UTSW 7 28563036 missense probably benign 0.34
R7262:Pak4 UTSW 7 28565200 missense possibly damaging 0.60
R7338:Pak4 UTSW 7 28564956 missense probably benign 0.37
R8709:Pak4 UTSW 7 28562544 missense probably benign 0.02
Z1088:Pak4 UTSW 7 28565228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCCCCAACATACAGCCTG -3'
(R):5'- CTAGGCAGGCTTCCACTATC -3'

Sequencing Primer
(F):5'- AAGCTCTGCGGTAGCCAAG -3'
(R):5'- GGCTTCCACTATCCACAGG -3'
Posted On2019-11-12