Incidental Mutation 'R7681:Myh10'
ID592772
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7681 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68771936 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 642 (T642I)
Ref Sequence ENSEMBL: ENSMUSP00000090661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably damaging
Transcript: ENSMUST00000018887
AA Change: T615I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: T615I

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092984
AA Change: T642I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: T642I

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102611
AA Change: T605I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: T605I

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Meta Mutation Damage Score 0.1815 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,849,619 A963V probably benign Het
Agbl1 T C 7: 76,444,901 V760A unknown Het
Akap13 T C 7: 75,728,796 F347L possibly damaging Het
Anapc5 A T 5: 122,802,139 F356L probably benign Het
Bmp6 A G 13: 38,346,195 H88R probably damaging Het
Cblb C A 16: 52,204,638 S921R probably damaging Het
Ccs T A 19: 4,832,830 probably null Het
Cyp20a1 A G 1: 60,353,033 T83A probably benign Het
Defa25 T A 8: 21,084,519 D26E probably benign Het
Dmwd T A 7: 19,081,082 N552K probably benign Het
Dnah17 C T 11: 118,025,186 V4297M probably damaging Het
Fam135a A T 1: 24,067,915 S47R probably benign Het
Fbxo41 A T 6: 85,478,479 C574* probably null Het
Fgb T C 3: 83,049,832 probably benign Het
Fgfr1 C T 8: 25,555,661 T82I probably damaging Het
Fhod3 T A 18: 24,990,038 L262M probably damaging Het
Galnt16 A T 12: 80,590,639 Q380L probably damaging Het
Glp2r C T 11: 67,709,679 G448D probably benign Het
Gm8765 C T 13: 50,702,254 P643S possibly damaging Het
Gnb4 C A 3: 32,587,753 A242S possibly damaging Het
Golim4 T C 3: 75,887,024 probably null Het
Grik2 G T 10: 49,244,380 N604K probably damaging Het
Hnf1b T G 11: 83,889,146 I435S probably damaging Het
Hoxa11 C T 6: 52,245,119 G201S probably benign Het
Hpse A G 5: 100,691,391 S364P possibly damaging Het
Kif16b A T 2: 142,756,126 N525K probably damaging Het
Kif1a A T 1: 93,054,944 C704S probably benign Het
Limk2 A G 11: 3,353,354 S322P probably damaging Het
Lrp1b A T 2: 40,874,999 C2938* probably null Het
Malrd1 A G 2: 16,218,102 R2071G unknown Het
Man2a2 T A 7: 80,351,749 I1137F possibly damaging Het
Map2k6 C T 11: 110,497,903 R224* probably null Het
Map3k4 G A 17: 12,318,543 P29L unknown Het
Morn5 A T 2: 36,057,144 N145Y possibly damaging Het
Muc20 T C 16: 32,793,619 T463A probably benign Het
Myh14 C A 7: 44,624,148 R1362L possibly damaging Het
Nup88 C A 11: 70,969,885 V23L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1221 A C 2: 89,111,591 V307G probably benign Het
Olfr1340 A G 4: 118,726,564 I106V probably benign Het
Olfr477 T C 7: 107,991,148 M261T possibly damaging Het
Pabpn1 T C 14: 54,898,042 Y299H probably damaging Het
Pak4 T C 7: 28,560,230 E514G probably damaging Het
Ppp1r12b A C 1: 134,865,935 S564A probably benign Het
Psmc2 T C 5: 21,803,274 probably null Het
Psme4 A G 11: 30,791,975 Y146C possibly damaging Het
Rb1cc1 A G 1: 6,240,323 D315G probably damaging Het
Rilpl1 A G 5: 124,530,913 V24A possibly damaging Het
Rtel1 A T 2: 181,322,394 H62L probably damaging Het
Ruvbl1 G A 6: 88,467,653 probably null Het
Scn5a A G 9: 119,529,977 V668A probably benign Het
Slc22a6 G A 19: 8,626,129 G519E probably benign Het
Slc43a2 T A 11: 75,563,673 I348N probably benign Het
Slc6a16 T A 7: 45,260,914 L347Q probably damaging Het
Smg6 T A 11: 74,931,705 L658H probably damaging Het
Spidr C A 16: 15,895,624 G832W probably damaging Het
Ssrp1 G A 2: 85,045,748 G616E probably benign Het
Sult1b1 G A 5: 87,530,636 L110F probably damaging Het
Tfec T A 6: 16,834,236 H224L probably benign Het
Ttn C T 2: 76,708,951 E34564K probably benign Het
Washc2 A G 6: 116,260,657 D1285G probably damaging Het
Zfp870 T C 17: 32,882,690 E555G probably benign Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
R7922:Myh10 UTSW 11 68808893 missense possibly damaging 0.56
R7938:Myh10 UTSW 11 68692501 missense unknown
R7958:Myh10 UTSW 11 68721347 missense probably benign 0.00
R7994:Myh10 UTSW 11 68790244 critical splice donor site probably null
R8395:Myh10 UTSW 11 68792016 missense probably damaging 0.98
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCTGCCATTGAGACGGTC -3'
(R):5'- GGTAACTTCTTACATATCGGCAGC -3'

Sequencing Primer
(F):5'- ATTGAGACGGTCCCCACAGTC -3'
(R):5'- CCGTGCTCTAGGGAAAGATTTTAAAG -3'
Posted On2019-11-12