Incidental Mutation 'R7681:Bmp6'
ID592780
Institutional Source Beutler Lab
Gene Symbol Bmp6
Ensembl Gene ENSMUSG00000039004
Gene Namebone morphogenetic protein 6
SynonymsVgr1, D13Wsu115e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7681 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location38345107-38500302 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38346195 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 88 (H88R)
Ref Sequence ENSEMBL: ENSMUSP00000126999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171970]
Predicted Effect probably damaging
Transcript: ENSMUST00000171970
AA Change: H88R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126999
Gene: ENSMUSG00000039004
AA Change: H88R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TGFb_propeptide 56 359 2.3e-100 PFAM
low complexity region 368 389 N/A INTRINSIC
TGFB 409 510 6.8e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates a wide range of biological processes including iron homeostasis, fat and bone development, and ovulation. Mice lacking this gene exhibit delayed ossification of the sternum, iron overload, and reduced fertility in females. [provided by RefSeq, Jul 2016]
PHENOTYPE: One homozygous null mutant showed delayed ossification in the developing sternum while females of a second null mutant were smaller than normal in size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,849,619 A963V probably benign Het
Agbl1 T C 7: 76,444,901 V760A unknown Het
Akap13 T C 7: 75,728,796 F347L possibly damaging Het
Anapc5 A T 5: 122,802,139 F356L probably benign Het
Cblb C A 16: 52,204,638 S921R probably damaging Het
Cyp20a1 A G 1: 60,353,033 T83A probably benign Het
Defa25 T A 8: 21,084,519 D26E probably benign Het
Dmwd T A 7: 19,081,082 N552K probably benign Het
Dnah17 C T 11: 118,025,186 V4297M probably damaging Het
Fam135a A T 1: 24,067,915 S47R probably benign Het
Fbxo41 A T 6: 85,478,479 C574* probably null Het
Fgb T C 3: 83,049,832 probably benign Het
Fgfr1 C T 8: 25,555,661 T82I probably damaging Het
Fhod3 T A 18: 24,990,038 L262M probably damaging Het
Galnt16 A T 12: 80,590,639 Q380L probably damaging Het
Glp2r C T 11: 67,709,679 G448D probably benign Het
Gm8765 C T 13: 50,702,254 P643S possibly damaging Het
Gnb4 C A 3: 32,587,753 A242S possibly damaging Het
Grik2 G T 10: 49,244,380 N604K probably damaging Het
Hnf1b T G 11: 83,889,146 I435S probably damaging Het
Hoxa11 C T 6: 52,245,119 G201S probably benign Het
Hpse A G 5: 100,691,391 S364P possibly damaging Het
Kif16b A T 2: 142,756,126 N525K probably damaging Het
Kif1a A T 1: 93,054,944 C704S probably benign Het
Limk2 A G 11: 3,353,354 S322P probably damaging Het
Lrp1b A T 2: 40,874,999 C2938* probably null Het
Malrd1 A G 2: 16,218,102 R2071G unknown Het
Man2a2 T A 7: 80,351,749 I1137F possibly damaging Het
Map2k6 C T 11: 110,497,903 R224* probably null Het
Morn5 A T 2: 36,057,144 N145Y possibly damaging Het
Muc20 T C 16: 32,793,619 T463A probably benign Het
Myh10 C T 11: 68,771,936 T642I probably damaging Het
Myh14 C A 7: 44,624,148 R1362L possibly damaging Het
Nup88 C A 11: 70,969,885 V23L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1221 A C 2: 89,111,591 V307G probably benign Het
Olfr1340 A G 4: 118,726,564 I106V probably benign Het
Olfr477 T C 7: 107,991,148 M261T possibly damaging Het
Pabpn1 T C 14: 54,898,042 Y299H probably damaging Het
Pak4 T C 7: 28,560,230 E514G probably damaging Het
Ppp1r12b A C 1: 134,865,935 S564A probably benign Het
Psmc2 T C 5: 21,803,274 probably null Het
Psme4 A G 11: 30,791,975 Y146C possibly damaging Het
Rb1cc1 A G 1: 6,240,323 D315G probably damaging Het
Rilpl1 A G 5: 124,530,913 V24A possibly damaging Het
Rtel1 A T 2: 181,322,394 H62L probably damaging Het
Ruvbl1 G A 6: 88,467,653 probably null Het
Scn5a A G 9: 119,529,977 V668A probably benign Het
Slc22a6 G A 19: 8,626,129 G519E probably benign Het
Slc43a2 T A 11: 75,563,673 I348N probably benign Het
Slc6a16 T A 7: 45,260,914 L347Q probably damaging Het
Smg6 T A 11: 74,931,705 L658H probably damaging Het
Spidr C A 16: 15,895,624 G832W probably damaging Het
Ssrp1 G A 2: 85,045,748 G616E probably benign Het
Sult1b1 G A 5: 87,530,636 L110F probably damaging Het
Tfec T A 6: 16,834,236 H224L probably benign Het
Ttn C T 2: 76,708,951 E34564K probably benign Het
Washc2 A G 6: 116,260,657 D1285G probably damaging Het
Zfp870 T C 17: 32,882,690 E555G probably benign Het
Other mutations in Bmp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Bmp6 APN 13 38469634 missense probably damaging 0.99
IGL01409:Bmp6 APN 13 38485889 missense probably damaging 1.00
IGL01646:Bmp6 APN 13 38498928 missense probably damaging 0.99
IGL01823:Bmp6 APN 13 38498822 missense probably damaging 1.00
IGL03000:Bmp6 APN 13 38498911 splice site probably benign
IGL03337:Bmp6 APN 13 38498943 missense probably damaging 1.00
PIT4431001:Bmp6 UTSW 13 38485930 missense probably benign
R1218:Bmp6 UTSW 13 38346250 small deletion probably benign
R1225:Bmp6 UTSW 13 38346281 missense probably benign
R4579:Bmp6 UTSW 13 38469725 missense probably damaging 1.00
R4834:Bmp6 UTSW 13 38485841 missense probably damaging 1.00
R5208:Bmp6 UTSW 13 38469697 missense probably benign 0.23
R5713:Bmp6 UTSW 13 38498952 missense probably damaging 1.00
R5842:Bmp6 UTSW 13 38346567 missense probably damaging 0.99
R6319:Bmp6 UTSW 13 38346414 missense probably benign 0.28
R7348:Bmp6 UTSW 13 38485903 missense probably benign 0.00
R7565:Bmp6 UTSW 13 38346257 nonsense probably null
R7669:Bmp6 UTSW 13 38484920 missense probably damaging 0.98
R7834:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
R7917:Bmp6 UTSW 13 38469667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACACCTGGCTCACTCAG -3'
(R):5'- TTCGTCGTCATTGGACAGGG -3'

Sequencing Primer
(F):5'- CCGCGGATGACCATGAGAG -3'
(R):5'- GCGTTGTAGAGATCCAGCATG -3'
Posted On2019-11-12