Incidental Mutation 'R7681:Slc22a6'
ID592788
Institutional Source Beutler Lab
Gene Symbol Slc22a6
Ensembl Gene ENSMUSG00000024650
Gene Namesolute carrier family 22 (organic anion transporter), member 6
SynonymsNKT, Oat1, mOat1, Orctl1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7681 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8617996-8628299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8626129 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 519 (G519E)
Ref Sequence ENSEMBL: ENSMUSP00000010250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010250]
Predicted Effect probably benign
Transcript: ENSMUST00000010250
AA Change: G519E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000010250
Gene: ENSMUSG00000024650
AA Change: G519E

DomainStartEndE-ValueType
Pfam:MFS_1 107 467 2.4e-25 PFAM
Pfam:Sugar_tr 107 512 8e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-dependent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and may be localized to the basolateral membrane. Four transcript variants encoding four different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene may result in increased thymus weight or impaired renal organic anion excretion for a subset of organic anions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C T 5: 8,849,619 A963V probably benign Het
Agbl1 T C 7: 76,444,901 V760A unknown Het
Akap13 T C 7: 75,728,796 F347L possibly damaging Het
Anapc5 A T 5: 122,802,139 F356L probably benign Het
Bmp6 A G 13: 38,346,195 H88R probably damaging Het
Cblb C A 16: 52,204,638 S921R probably damaging Het
Ccs T A 19: 4,832,830 probably null Het
Cyp20a1 A G 1: 60,353,033 T83A probably benign Het
Defa25 T A 8: 21,084,519 D26E probably benign Het
Dmwd T A 7: 19,081,082 N552K probably benign Het
Dnah17 C T 11: 118,025,186 V4297M probably damaging Het
Fam135a A T 1: 24,067,915 S47R probably benign Het
Fbxo41 A T 6: 85,478,479 C574* probably null Het
Fgb T C 3: 83,049,832 probably benign Het
Fgfr1 C T 8: 25,555,661 T82I probably damaging Het
Fhod3 T A 18: 24,990,038 L262M probably damaging Het
Galnt16 A T 12: 80,590,639 Q380L probably damaging Het
Glp2r C T 11: 67,709,679 G448D probably benign Het
Gm8765 C T 13: 50,702,254 P643S possibly damaging Het
Gnb4 C A 3: 32,587,753 A242S possibly damaging Het
Golim4 T C 3: 75,887,024 probably null Het
Grik2 G T 10: 49,244,380 N604K probably damaging Het
Hnf1b T G 11: 83,889,146 I435S probably damaging Het
Hoxa11 C T 6: 52,245,119 G201S probably benign Het
Hpse A G 5: 100,691,391 S364P possibly damaging Het
Kif16b A T 2: 142,756,126 N525K probably damaging Het
Kif1a A T 1: 93,054,944 C704S probably benign Het
Limk2 A G 11: 3,353,354 S322P probably damaging Het
Lrp1b A T 2: 40,874,999 C2938* probably null Het
Malrd1 A G 2: 16,218,102 R2071G unknown Het
Man2a2 T A 7: 80,351,749 I1137F possibly damaging Het
Map2k6 C T 11: 110,497,903 R224* probably null Het
Map3k4 G A 17: 12,318,543 P29L unknown Het
Morn5 A T 2: 36,057,144 N145Y possibly damaging Het
Muc20 T C 16: 32,793,619 T463A probably benign Het
Myh10 C T 11: 68,771,936 T642I probably damaging Het
Myh14 C A 7: 44,624,148 R1362L possibly damaging Het
Nup88 C A 11: 70,969,885 V23L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1221 A C 2: 89,111,591 V307G probably benign Het
Olfr1340 A G 4: 118,726,564 I106V probably benign Het
Olfr477 T C 7: 107,991,148 M261T possibly damaging Het
Pabpn1 T C 14: 54,898,042 Y299H probably damaging Het
Pak4 T C 7: 28,560,230 E514G probably damaging Het
Ppp1r12b A C 1: 134,865,935 S564A probably benign Het
Psmc2 T C 5: 21,803,274 probably null Het
Psme4 A G 11: 30,791,975 Y146C possibly damaging Het
Rb1cc1 A G 1: 6,240,323 D315G probably damaging Het
Rilpl1 A G 5: 124,530,913 V24A possibly damaging Het
Rtel1 A T 2: 181,322,394 H62L probably damaging Het
Ruvbl1 G A 6: 88,467,653 probably null Het
Scn5a A G 9: 119,529,977 V668A probably benign Het
Slc43a2 T A 11: 75,563,673 I348N probably benign Het
Slc6a16 T A 7: 45,260,914 L347Q probably damaging Het
Smg6 T A 11: 74,931,705 L658H probably damaging Het
Spidr C A 16: 15,895,624 G832W probably damaging Het
Ssrp1 G A 2: 85,045,748 G616E probably benign Het
Sult1b1 G A 5: 87,530,636 L110F probably damaging Het
Tfec T A 6: 16,834,236 H224L probably benign Het
Ttn C T 2: 76,708,951 E34564K probably benign Het
Washc2 A G 6: 116,260,657 D1285G probably damaging Het
Zfp870 T C 17: 32,882,690 E555G probably benign Het
Other mutations in Slc22a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc22a6 APN 19 8621868 missense probably benign 0.14
IGL00825:Slc22a6 APN 19 8618357 missense possibly damaging 0.94
IGL01362:Slc22a6 APN 19 8621208 missense possibly damaging 0.69
IGL01843:Slc22a6 APN 19 8626214 utr 3 prime probably benign
IGL02583:Slc22a6 APN 19 8623616 missense possibly damaging 0.79
R1004:Slc22a6 UTSW 19 8618399 missense probably damaging 1.00
R1775:Slc22a6 UTSW 19 8619107 critical splice donor site probably null
R1911:Slc22a6 UTSW 19 8621882 missense probably benign
R2365:Slc22a6 UTSW 19 8619397 missense probably benign
R3406:Slc22a6 UTSW 19 8621311 missense probably damaging 1.00
R4106:Slc22a6 UTSW 19 8618510 missense probably benign
R4693:Slc22a6 UTSW 19 8623652 missense probably damaging 1.00
R5094:Slc22a6 UTSW 19 8626177 missense probably damaging 1.00
R5347:Slc22a6 UTSW 19 8618553 missense possibly damaging 0.94
R5360:Slc22a6 UTSW 19 8619422 missense probably damaging 1.00
R5667:Slc22a6 UTSW 19 8621784 critical splice acceptor site probably null
R5810:Slc22a6 UTSW 19 8623858 missense probably damaging 1.00
R6176:Slc22a6 UTSW 19 8621797 missense probably damaging 1.00
R6336:Slc22a6 UTSW 19 8622130 missense probably benign 0.02
R6864:Slc22a6 UTSW 19 8618441 missense probably damaging 1.00
R6954:Slc22a6 UTSW 19 8622096 missense probably benign 0.02
R7298:Slc22a6 UTSW 19 8621320 missense possibly damaging 0.49
R7305:Slc22a6 UTSW 19 8622158 critical splice donor site probably null
R7749:Slc22a6 UTSW 19 8621896 missense possibly damaging 0.48
Z1088:Slc22a6 UTSW 19 8621833 missense probably benign 0.03
Z1176:Slc22a6 UTSW 19 8623543 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTCTCCAAGTGGAAGATTCTC -3'
(R):5'- CCTTTGGGGAGGCATTTCTC -3'

Sequencing Primer
(F):5'- GGAAGATTCTCCCATAATCCTTGTG -3'
(R):5'- AATGGCAGGCTCCGCATTTAG -3'
Posted On2019-11-12