Incidental Mutation 'R7682:Vmn2r11'
ID592815
Institutional Source Beutler Lab
Gene Symbol Vmn2r11
Ensembl Gene ENSMUSG00000091450
Gene Namevomeronasal 2, receptor 11
SynonymsEG384219
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7682 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location109046873-109059452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 109047615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 615 (V615G)
Ref Sequence ENSEMBL: ENSMUSP00000133218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164875]
Predicted Effect probably benign
Transcript: ENSMUST00000164875
AA Change: V615G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133218
Gene: ENSMUSG00000091450
AA Change: V615G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 167 475 1.6e-29 PFAM
Pfam:NCD3G 520 574 9.1e-19 PFAM
Pfam:7tm_3 607 842 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,485 S196T probably benign Het
Abcc5 T C 16: 20,368,053 D977G probably damaging Het
Acot2 T C 12: 83,987,924 V8A probably benign Het
Adamts9 T A 6: 92,880,698 I870F possibly damaging Het
Adgrl3 G A 5: 81,794,560 V1414I probably damaging Het
Aggf1 T C 13: 95,368,426 K275R probably benign Het
Alpk1 T C 3: 127,672,546 I1104V possibly damaging Het
Angptl7 A T 4: 148,498,082 I119N probably damaging Het
Ank3 A T 10: 69,988,235 E129D possibly damaging Het
Brca2 T A 5: 150,543,153 H2127Q probably benign Het
Brd4 A G 17: 32,201,160 F1008S unknown Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Casp3 A G 8: 46,632,385 Y41C probably benign Het
Ces4a A T 8: 105,146,665 T381S probably benign Het
Clstn1 A G 4: 149,626,101 T77A possibly damaging Het
Cul7 G T 17: 46,655,595 V615L probably benign Het
Dnpep A G 1: 75,316,740 F24L probably damaging Het
Emsy G A 7: 98,590,698 R1263W probably damaging Het
Fam124b A T 1: 80,213,565 C34S possibly damaging Het
Fan1 C A 7: 64,372,764 G247V probably benign Het
Glipr1l3 T G 10: 112,141,872 H218P probably benign Het
Gm13084 A G 4: 143,810,720 L347S probably benign Het
Gm14305 T A 2: 176,720,910 S198R probably benign Het
Gm14326 T C 2: 177,948,481 Y29C probably damaging Het
Gm45713 C T 7: 45,134,002 V147I probably benign Het
Gpr149 C T 3: 62,530,739 D666N probably damaging Het
Gpr183 A G 14: 121,954,740 I123T possibly damaging Het
Il7r A T 15: 9,512,927 H165Q probably damaging Het
Krt73 A G 15: 101,802,045 F85L probably benign Het
Lrrc29 C A 8: 105,315,284 R304L possibly damaging Het
Lrrc8d A G 5: 105,812,791 T356A probably damaging Het
Marco A G 1: 120,494,042 probably null Het
Mettl14 T A 3: 123,383,604 E49D possibly damaging Het
Mrps34 C T 17: 24,895,878 A152V probably benign Het
Nfasc T A 1: 132,573,773 Y1163F unknown Het
Nfic T C 10: 81,420,500 D110G probably damaging Het
Nip7 T C 8: 107,057,119 V28A possibly damaging Het
Odam T C 5: 87,892,428 F251S possibly damaging Het
Olfm5 T A 7: 104,161,772 Q53L probably null Het
P2ry13 T G 3: 59,210,124 M78L probably benign Het
Pacs1 T C 19: 5,152,699 E385G probably damaging Het
Pip5k1b C T 19: 24,359,979 G315D probably damaging Het
Pla2g4a C A 1: 149,886,271 R145L probably damaging Het
Rars T C 11: 35,828,752 Q81R probably benign Het
Rassf7 A G 7: 141,217,934 N296D probably damaging Het
Rcsd1 C T 1: 165,657,693 A94T probably benign Het
Rgs8 T C 1: 153,690,922 F73S probably damaging Het
Rilpl2 A C 5: 124,477,980 Y36D probably damaging Het
Rpl10l A G 12: 66,284,230 V43A probably benign Het
Sesn2 T C 4: 132,496,889 I403V probably damaging Het
Slc10a4 C T 5: 73,007,110 S15L unknown Het
Slc7a5 T C 8: 121,907,140 Y156C probably damaging Het
Spata18 A G 5: 73,668,665 H105R Het
Specc1l A G 10: 75,245,802 D344G probably damaging Het
Syne1 A G 10: 5,162,461 V415A probably benign Het
Thbs4 T G 13: 92,775,562 D220A probably benign Het
Tmco5 T C 2: 116,886,271 S152P probably benign Het
Tmem35b A T 4: 127,128,941 D125V probably damaging Het
Trim17 A G 11: 58,966,808 E155G possibly damaging Het
Vmn2r88 A T 14: 51,418,449 Q705L Het
Vmn2r93 A G 17: 18,305,321 R414G probably benign Het
Xirp2 T C 2: 67,508,849 L478P probably damaging Het
Other mutations in Vmn2r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Vmn2r11 APN 5 109047019 missense probably benign 0.00
IGL01677:Vmn2r11 APN 5 109053957 missense possibly damaging 0.50
IGL02048:Vmn2r11 APN 5 109054792 missense probably benign 0.00
IGL02559:Vmn2r11 APN 5 109052180 missense probably damaging 0.98
IGL02879:Vmn2r11 APN 5 109053838 missense possibly damaging 0.95
IGL03084:Vmn2r11 APN 5 109059343 missense probably benign 0.00
IGL03163:Vmn2r11 APN 5 109053826 missense probably benign 0.41
IGL03289:Vmn2r11 APN 5 109048922 splice site probably benign
IGL03294:Vmn2r11 APN 5 109054069 missense probably benign 0.22
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0233:Vmn2r11 UTSW 5 109054102 missense probably benign 0.16
R0421:Vmn2r11 UTSW 5 109059428 missense probably benign 0.00
R0549:Vmn2r11 UTSW 5 109052097 missense possibly damaging 0.80
R0628:Vmn2r11 UTSW 5 109047731 missense possibly damaging 0.88
R1523:Vmn2r11 UTSW 5 109053841 missense probably benign 0.25
R1660:Vmn2r11 UTSW 5 109053858 missense possibly damaging 0.79
R1827:Vmn2r11 UTSW 5 109052072 missense probably benign 0.01
R1913:Vmn2r11 UTSW 5 109054788 missense probably benign
R2260:Vmn2r11 UTSW 5 109053791 nonsense probably null
R2400:Vmn2r11 UTSW 5 109052062 missense probably benign 0.03
R3933:Vmn2r11 UTSW 5 109053394 missense probably damaging 0.97
R4091:Vmn2r11 UTSW 5 109054750 critical splice donor site probably null
R4624:Vmn2r11 UTSW 5 109052235 missense probably damaging 0.99
R4762:Vmn2r11 UTSW 5 109047570 missense probably damaging 1.00
R5256:Vmn2r11 UTSW 5 109054792 missense probably benign 0.26
R5370:Vmn2r11 UTSW 5 109047555 missense probably damaging 1.00
R5419:Vmn2r11 UTSW 5 109059358 missense possibly damaging 0.55
R5516:Vmn2r11 UTSW 5 109047166 missense probably damaging 0.98
R5643:Vmn2r11 UTSW 5 109047003 missense probably damaging 1.00
R5671:Vmn2r11 UTSW 5 109054906 missense probably benign 0.03
R5679:Vmn2r11 UTSW 5 109054842 missense probably benign 0.00
R5739:Vmn2r11 UTSW 5 109059248 critical splice donor site probably null
R5746:Vmn2r11 UTSW 5 109053694 missense probably benign 0.41
R5995:Vmn2r11 UTSW 5 109047055 missense probably damaging 1.00
R6147:Vmn2r11 UTSW 5 109054834 missense probably benign 0.04
R6220:Vmn2r11 UTSW 5 109053568 missense probably benign 0.09
R6374:Vmn2r11 UTSW 5 109053813 missense possibly damaging 0.65
R6491:Vmn2r11 UTSW 5 109048934 missense possibly damaging 0.95
R6804:Vmn2r11 UTSW 5 109053484 missense probably damaging 1.00
R6814:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R6872:Vmn2r11 UTSW 5 109047110 missense possibly damaging 0.81
R7014:Vmn2r11 UTSW 5 109053423 missense probably damaging 1.00
R7041:Vmn2r11 UTSW 5 109054950 missense probably damaging 1.00
R7043:Vmn2r11 UTSW 5 109052232 missense probably benign 0.00
R7050:Vmn2r11 UTSW 5 109054791 missense probably benign 0.05
R7184:Vmn2r11 UTSW 5 109053415 missense probably damaging 1.00
R7388:Vmn2r11 UTSW 5 109054876 missense probably benign 0.05
R7477:Vmn2r11 UTSW 5 109059348 missense possibly damaging 0.67
R7524:Vmn2r11 UTSW 5 109053982 missense probably benign 0.01
R7715:Vmn2r11 UTSW 5 109047441 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTTGAAAGCCATGAGCACAG -3'
(R):5'- TCTTTGCCAGCAGATATGGAAC -3'

Sequencing Primer
(F):5'- ACACTGTAGAAATAGCCACTGTG -3'
(R):5'- AACAGTGTGTGAGGTGTCCAG -3'
Posted On2019-11-12