Incidental Mutation 'R7682:Trim17'
ID592835
Institutional Source Beutler Lab
Gene Symbol Trim17
Ensembl Gene ENSMUSG00000036964
Gene Nametripartite motif-containing 17
Synonymsterf, Rnf16
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7682 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58954685-58973098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58966808 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 155 (E155G)
Ref Sequence ENSEMBL: ENSMUSP00000074639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047697] [ENSMUST00000075141]
Predicted Effect probably benign
Transcript: ENSMUST00000047697
AA Change: E155G

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037248
Gene: ENSMUSG00000036964
AA Change: E155G

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075141
AA Change: E155G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000074639
Gene: ENSMUSG00000036964
AA Change: E155G

DomainStartEndE-ValueType
RING 16 65 1.17e-10 SMART
BBOX 94 135 4.1e-15 SMART
coiled coil region 143 180 N/A INTRINSIC
PRY 294 347 8.95e-16 SMART
SPRY 348 472 2.54e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein is expressed almost exclusively in the testis, but its function is unknown. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,485 S196T probably benign Het
Abcc5 T C 16: 20,368,053 D977G probably damaging Het
Acot2 T C 12: 83,987,924 V8A probably benign Het
Adamts9 T A 6: 92,880,698 I870F possibly damaging Het
Adgrl3 G A 5: 81,794,560 V1414I probably damaging Het
Aggf1 T C 13: 95,368,426 K275R probably benign Het
Alpk1 T C 3: 127,672,546 I1104V possibly damaging Het
Angptl7 A T 4: 148,498,082 I119N probably damaging Het
Ank3 A T 10: 69,988,235 E129D possibly damaging Het
Brca2 T A 5: 150,543,153 H2127Q probably benign Het
Brd4 A G 17: 32,201,160 F1008S unknown Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Casp3 A G 8: 46,632,385 Y41C probably benign Het
Ces4a A T 8: 105,146,665 T381S probably benign Het
Clstn1 A G 4: 149,626,101 T77A possibly damaging Het
Cul7 G T 17: 46,655,595 V615L probably benign Het
Dnpep A G 1: 75,316,740 F24L probably damaging Het
Emsy G A 7: 98,590,698 R1263W probably damaging Het
Fam124b A T 1: 80,213,565 C34S possibly damaging Het
Fan1 C A 7: 64,372,764 G247V probably benign Het
Glipr1l3 T G 10: 112,141,872 H218P probably benign Het
Gm13084 A G 4: 143,810,720 L347S probably benign Het
Gm14305 T A 2: 176,720,910 S198R probably benign Het
Gm14326 T C 2: 177,948,481 Y29C probably damaging Het
Gm45713 C T 7: 45,134,002 V147I probably benign Het
Gpr149 C T 3: 62,530,739 D666N probably damaging Het
Gpr183 A G 14: 121,954,740 I123T possibly damaging Het
Il7r A T 15: 9,512,927 H165Q probably damaging Het
Krt73 A G 15: 101,802,045 F85L probably benign Het
Lrrc29 C A 8: 105,315,284 R304L possibly damaging Het
Lrrc8d A G 5: 105,812,791 T356A probably damaging Het
Marco A G 1: 120,494,042 probably null Het
Mettl14 T A 3: 123,383,604 E49D possibly damaging Het
Mrps34 C T 17: 24,895,878 A152V probably benign Het
Nfasc T A 1: 132,573,773 Y1163F unknown Het
Nfic T C 10: 81,420,500 D110G probably damaging Het
Nip7 T C 8: 107,057,119 V28A possibly damaging Het
Odam T C 5: 87,892,428 F251S possibly damaging Het
Olfm5 T A 7: 104,161,772 Q53L probably null Het
P2ry13 T G 3: 59,210,124 M78L probably benign Het
Pacs1 T C 19: 5,152,699 E385G probably damaging Het
Pip5k1b C T 19: 24,359,979 G315D probably damaging Het
Pla2g4a C A 1: 149,886,271 R145L probably damaging Het
Rars T C 11: 35,828,752 Q81R probably benign Het
Rassf7 A G 7: 141,217,934 N296D probably damaging Het
Rcsd1 C T 1: 165,657,693 A94T probably benign Het
Rgs8 T C 1: 153,690,922 F73S probably damaging Het
Rilpl2 A C 5: 124,477,980 Y36D probably damaging Het
Rpl10l A G 12: 66,284,230 V43A probably benign Het
Sesn2 T C 4: 132,496,889 I403V probably damaging Het
Slc10a4 C T 5: 73,007,110 S15L unknown Het
Slc7a5 T C 8: 121,907,140 Y156C probably damaging Het
Spata18 A G 5: 73,668,665 H105R Het
Specc1l A G 10: 75,245,802 D344G probably damaging Het
Syne1 A G 10: 5,162,461 V415A probably benign Het
Thbs4 T G 13: 92,775,562 D220A probably benign Het
Tmco5 T C 2: 116,886,271 S152P probably benign Het
Tmem35b A T 4: 127,128,941 D125V probably damaging Het
Vmn2r11 A C 5: 109,047,615 V615G probably benign Het
Vmn2r88 A T 14: 51,418,449 Q705L Het
Vmn2r93 A G 17: 18,305,321 R414G probably benign Het
Xirp2 T C 2: 67,508,849 L478P probably damaging Het
Other mutations in Trim17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Trim17 APN 11 58970597 missense probably damaging 1.00
IGL02581:Trim17 APN 11 58971076 nonsense probably null
P0026:Trim17 UTSW 11 58971258 missense possibly damaging 0.83
R0518:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0521:Trim17 UTSW 11 58968494 missense probably damaging 0.99
R0765:Trim17 UTSW 11 58971369 missense possibly damaging 0.73
R1165:Trim17 UTSW 11 58971215 missense possibly damaging 0.92
R1441:Trim17 UTSW 11 58965192 missense probably damaging 1.00
R2164:Trim17 UTSW 11 58971411 missense probably damaging 1.00
R2320:Trim17 UTSW 11 58966798 missense probably benign
R3436:Trim17 UTSW 11 58965233 missense probably damaging 1.00
R4715:Trim17 UTSW 11 58968450 intron probably benign
R4832:Trim17 UTSW 11 58971444 missense probably damaging 0.97
R4928:Trim17 UTSW 11 58954301 unclassified probably benign
R4950:Trim17 UTSW 11 58970428 missense probably damaging 0.98
R5339:Trim17 UTSW 11 58954510 unclassified probably null
R5909:Trim17 UTSW 11 58968680 missense probably damaging 1.00
R5915:Trim17 UTSW 11 58968562 missense probably damaging 0.99
R5947:Trim17 UTSW 11 58965543 missense probably damaging 1.00
R6732:Trim17 UTSW 11 58971025 critical splice acceptor site probably null
R7027:Trim17 UTSW 11 58968616 missense probably benign 0.08
R7143:Trim17 UTSW 11 58965184 nonsense probably null
R7168:Trim17 UTSW 11 58968578 missense probably benign
R7707:Trim17 UTSW 11 58965284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAAAGCCCAGGTCAAGAGAG -3'
(R):5'- GGCTCAATTTGTAGGTCAGGC -3'

Sequencing Primer
(F):5'- CAGGTCAAGAGAGGCTCATTTCC -3'
(R):5'- AGGCACCGAACCTGCAGAG -3'
Posted On2019-11-12