Incidental Mutation 'R7682:Acot2'
ID592837
Institutional Source Beutler Lab
Gene Symbol Acot2
Ensembl Gene ENSMUSG00000021226
Gene Nameacyl-CoA thioesterase 2
SynonymsMTE-I, Mte1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7682 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83987861-83993873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83987924 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 8 (V8A)
Ref Sequence ENSEMBL: ENSMUSP00000021649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021649] [ENSMUST00000164935]
Predicted Effect probably benign
Transcript: ENSMUST00000021649
AA Change: V8A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000021649
Gene: ENSMUSG00000021226
AA Change: V8A

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 57 182 3e-45 PFAM
low complexity region 189 202 N/A INTRINSIC
Pfam:BAAT_C 244 451 7.6e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164935
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase protein family, and is one of four acyl-CoA hydrolase genes located in a cluster on chromosome 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,485 S196T probably benign Het
Abcc5 T C 16: 20,368,053 D977G probably damaging Het
Adamts9 T A 6: 92,880,698 I870F possibly damaging Het
Adgrl3 G A 5: 81,794,560 V1414I probably damaging Het
Aggf1 T C 13: 95,368,426 K275R probably benign Het
Alpk1 T C 3: 127,672,546 I1104V possibly damaging Het
Angptl7 A T 4: 148,498,082 I119N probably damaging Het
Ank3 A T 10: 69,988,235 E129D possibly damaging Het
Brca2 T A 5: 150,543,153 H2127Q probably benign Het
Brd4 A G 17: 32,201,160 F1008S unknown Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Casp3 A G 8: 46,632,385 Y41C probably benign Het
Ces4a A T 8: 105,146,665 T381S probably benign Het
Clstn1 A G 4: 149,626,101 T77A possibly damaging Het
Cul7 G T 17: 46,655,595 V615L probably benign Het
Dnpep A G 1: 75,316,740 F24L probably damaging Het
Emsy G A 7: 98,590,698 R1263W probably damaging Het
Fam124b A T 1: 80,213,565 C34S possibly damaging Het
Fan1 C A 7: 64,372,764 G247V probably benign Het
Glipr1l3 T G 10: 112,141,872 H218P probably benign Het
Gm11639 T A 11: 104,964,348 probably null Het
Gm13084 A G 4: 143,810,720 L347S probably benign Het
Gm14305 T A 2: 176,720,910 S198R probably benign Het
Gm14326 T C 2: 177,948,481 Y29C probably damaging Het
Gm45713 C T 7: 45,134,002 V147I probably benign Het
Gpr149 C T 3: 62,530,739 D666N probably damaging Het
Gpr183 A G 14: 121,954,740 I123T possibly damaging Het
Il7r A T 15: 9,512,927 H165Q probably damaging Het
Krt73 A G 15: 101,802,045 F85L probably benign Het
Lrrc29 C A 8: 105,315,284 R304L possibly damaging Het
Lrrc8d A G 5: 105,812,791 T356A probably damaging Het
Marco A G 1: 120,494,042 probably null Het
Mettl14 T A 3: 123,383,604 E49D possibly damaging Het
Mrap T A 16: 90,749,222 probably null Het
Mrps34 C T 17: 24,895,878 A152V probably benign Het
Nfasc T A 1: 132,573,773 Y1163F unknown Het
Nfic T C 10: 81,420,500 D110G probably damaging Het
Nip7 T C 8: 107,057,119 V28A possibly damaging Het
Odam T C 5: 87,892,428 F251S possibly damaging Het
Olfm5 T A 7: 104,161,772 Q53L probably null Het
P2ry13 T G 3: 59,210,124 M78L probably benign Het
Pacs1 T C 19: 5,152,699 E385G probably damaging Het
Pip5k1b C T 19: 24,359,979 G315D probably damaging Het
Pla2g4a C A 1: 149,886,271 R145L probably damaging Het
Rars T C 11: 35,828,752 Q81R probably benign Het
Rassf7 A G 7: 141,217,934 N296D probably damaging Het
Rcsd1 C T 1: 165,657,693 A94T probably benign Het
Rgs8 T C 1: 153,690,922 F73S probably damaging Het
Rilpl2 A C 5: 124,477,980 Y36D probably damaging Het
Rpl10l A G 12: 66,284,230 V43A probably benign Het
Sesn2 T C 4: 132,496,889 I403V probably damaging Het
Slc10a4 C T 5: 73,007,110 S15L unknown Het
Slc7a5 T C 8: 121,907,140 Y156C probably damaging Het
Spata18 A G 5: 73,668,665 H105R Het
Specc1l A G 10: 75,245,802 D344G probably damaging Het
Syne1 A G 10: 5,162,461 V415A probably benign Het
Thbs4 T G 13: 92,775,562 D220A probably benign Het
Tmco5 T C 2: 116,886,271 S152P probably benign Het
Tmem35b A T 4: 127,128,941 D125V probably damaging Het
Trim17 A G 11: 58,966,808 E155G possibly damaging Het
Vmn2r11 A C 5: 109,047,615 V615G probably benign Het
Vmn2r88 A T 14: 51,418,449 Q705L Het
Vmn2r93 A G 17: 18,305,321 R414G probably benign Het
Xirp2 T C 2: 67,508,849 L478P probably damaging Het
Other mutations in Acot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0417:Acot2 UTSW 12 83990613 missense probably benign 0.36
R1101:Acot2 UTSW 12 83992850 missense probably benign 0.22
R1609:Acot2 UTSW 12 83992856 missense possibly damaging 0.93
R2267:Acot2 UTSW 12 83990560 missense probably damaging 1.00
R6166:Acot2 UTSW 12 83992604 missense probably damaging 1.00
R7384:Acot2 UTSW 12 83992667 missense probably benign
R7655:Acot2 UTSW 12 83992917 missense probably benign 0.05
R7656:Acot2 UTSW 12 83992917 missense probably benign 0.05
R7796:Acot2 UTSW 12 83988483 critical splice donor site probably null
R7845:Acot2 UTSW 12 83992988 nonsense probably null
R7864:Acot2 UTSW 12 83988022 missense probably benign 0.02
X0021:Acot2 UTSW 12 83988085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCGTCACTACTACTTTTGC -3'
(R):5'- AAGAAGTGACGCTCGTGCAC -3'

Sequencing Primer
(F):5'- AAGCGTCACTACTACTTTTGCTTTTG -3'
(R):5'- ACGTCGCGCTTGATCAG -3'
Posted On2019-11-12