Mutagenetix > Incidental Mutation

Incidental Mutation 'R7682:Thbs4'

592838

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

045748-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7682 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 92775562 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 220 (D220A)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably benign
Transcript: ENSMUST00000022213
AA Change: D220A

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: D220A

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	T	A	16: 88,759,485	S196T	probably benign	Het
Abcc5	T	C	16: 20,368,053	D977G	probably damaging	Het
Acot2	T	C	12: 83,987,924	V8A	probably benign	Het
Adamts9	T	A	6: 92,880,698	I870F	possibly damaging	Het
Adgrl3	G	A	5: 81,794,560	V1414I	probably damaging	Het
Aggf1	T	C	13: 95,368,426	K275R	probably benign	Het
Alpk1	T	C	3: 127,672,546	I1104V	possibly damaging	Het
Angptl7	A	T	4: 148,498,082	I119N	probably damaging	Het
Ank3	A	T	10: 69,988,235	E129D	possibly damaging	Het
Brca2	T	A	5: 150,543,153	H2127Q	probably benign	Het
Brd4	A	G	17: 32,201,160	F1008S	unknown	Het
Car2	T	C	3: 14,887,965	S56P	probably damaging	Het
Casp3	A	G	8: 46,632,385	Y41C	probably benign	Het
Ces4a	A	T	8: 105,146,665	T381S	probably benign	Het
Clstn1	A	G	4: 149,626,101	T77A	possibly damaging	Het
Cul7	G	T	17: 46,655,595	V615L	probably benign	Het
Dnpep	A	G	1: 75,316,740	F24L	probably damaging	Het
Emsy	G	A	7: 98,590,698	R1263W	probably damaging	Het
Fam124b	A	T	1: 80,213,565	C34S	possibly damaging	Het
Fan1	C	A	7: 64,372,764	G247V	probably benign	Het
Glipr1l3	T	G	10: 112,141,872	H218P	probably benign	Het
Gm11639	T	A	11: 104,964,348		probably null	Het
Gm13084	A	G	4: 143,810,720	L347S	probably benign	Het
Gm14305	T	A	2: 176,720,910	S198R	probably benign	Het
Gm14326	T	C	2: 177,948,481	Y29C	probably damaging	Het
Gm45713	C	T	7: 45,134,002	V147I	probably benign	Het
Gpr149	C	T	3: 62,530,739	D666N	probably damaging	Het
Gpr183	A	G	14: 121,954,740	I123T	possibly damaging	Het
Il7r	A	T	15: 9,512,927	H165Q	probably damaging	Het
Krt73	A	G	15: 101,802,045	F85L	probably benign	Het
Lrrc29	C	A	8: 105,315,284	R304L	possibly damaging	Het
Lrrc8d	A	G	5: 105,812,791	T356A	probably damaging	Het
Marco	A	G	1: 120,494,042		probably null	Het
Mettl14	T	A	3: 123,383,604	E49D	possibly damaging	Het
Mrap	T	A	16: 90,749,222		probably null	Het
Mrps34	C	T	17: 24,895,878	A152V	probably benign	Het
Nfasc	T	A	1: 132,573,773	Y1163F	unknown	Het
Nfic	T	C	10: 81,420,500	D110G	probably damaging	Het
Nip7	T	C	8: 107,057,119	V28A	possibly damaging	Het
Odam	T	C	5: 87,892,428	F251S	possibly damaging	Het
Olfm5	T	A	7: 104,161,772	Q53L	probably null	Het
P2ry13	T	G	3: 59,210,124	M78L	probably benign	Het
Pacs1	T	C	19: 5,152,699	E385G	probably damaging	Het
Pip5k1b	C	T	19: 24,359,979	G315D	probably damaging	Het
Pla2g4a	C	A	1: 149,886,271	R145L	probably damaging	Het
Rars	T	C	11: 35,828,752	Q81R	probably benign	Het
Rassf7	A	G	7: 141,217,934	N296D	probably damaging	Het
Rcsd1	C	T	1: 165,657,693	A94T	probably benign	Het
Rgs8	T	C	1: 153,690,922	F73S	probably damaging	Het
Rilpl2	A	C	5: 124,477,980	Y36D	probably damaging	Het
Rpl10l	A	G	12: 66,284,230	V43A	probably benign	Het
Sesn2	T	C	4: 132,496,889	I403V	probably damaging	Het
Slc10a4	C	T	5: 73,007,110	S15L	unknown	Het
Slc7a5	T	C	8: 121,907,140	Y156C	probably damaging	Het
Spata18	A	G	5: 73,668,665	H105R		Het
Specc1l	A	G	10: 75,245,802	D344G	probably damaging	Het
Syne1	A	G	10: 5,162,461	V415A	probably benign	Het
Tmco5	T	C	2: 116,886,271	S152P	probably benign	Het
Tmem35b	A	T	4: 127,128,941	D125V	probably damaging	Het
Trim17	A	G	11: 58,966,808	E155G	possibly damaging	Het
Vmn2r11	A	C	5: 109,047,615	V615G	probably benign	Het
Vmn2r88	A	T	14: 51,418,449	Q705L		Het
Vmn2r93	A	G	17: 18,305,321	R414G	probably benign	Het
Xirp2	T	C	2: 67,508,849	L478P	probably damaging	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTCACTACAAGCATGATCTCC -3'
(R):5'- AGCAATTATTTGAGGAGTCAGCTG -3'

Sequencing Primer
(F):5'- AAGCATGATCTCCTTTTCTTTGGATG -3'
(R):5'- TGACTGTCATCAATCAGACACAGAGG -3'

Posted On

2019-11-12