Incidental Mutation 'R7682:Abcc5'
ID592844
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms2900011L11Rik, Abcc5a, Mrp5, Abcc5b
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7682 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20331303-20426394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20368053 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 977 (D977G)
Ref Sequence ENSEMBL: ENSMUSP00000078158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547]
Predicted Effect probably damaging
Transcript: ENSMUST00000079158
AA Change: D977G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: D977G

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115547
AA Change: D977G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: D977G

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (62/62)
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik T A 16: 88,759,485 S196T probably benign Het
Acot2 T C 12: 83,987,924 V8A probably benign Het
Adamts9 T A 6: 92,880,698 I870F possibly damaging Het
Adgrl3 G A 5: 81,794,560 V1414I probably damaging Het
Aggf1 T C 13: 95,368,426 K275R probably benign Het
Alpk1 T C 3: 127,672,546 I1104V possibly damaging Het
Angptl7 A T 4: 148,498,082 I119N probably damaging Het
Ank3 A T 10: 69,988,235 E129D possibly damaging Het
Brca2 T A 5: 150,543,153 H2127Q probably benign Het
Brd4 A G 17: 32,201,160 F1008S unknown Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Casp3 A G 8: 46,632,385 Y41C probably benign Het
Ces4a A T 8: 105,146,665 T381S probably benign Het
Clstn1 A G 4: 149,626,101 T77A possibly damaging Het
Cul7 G T 17: 46,655,595 V615L probably benign Het
Dnpep A G 1: 75,316,740 F24L probably damaging Het
Emsy G A 7: 98,590,698 R1263W probably damaging Het
Fam124b A T 1: 80,213,565 C34S possibly damaging Het
Fan1 C A 7: 64,372,764 G247V probably benign Het
Glipr1l3 T G 10: 112,141,872 H218P probably benign Het
Gm11639 T A 11: 104,964,348 probably null Het
Gm13084 A G 4: 143,810,720 L347S probably benign Het
Gm14305 T A 2: 176,720,910 S198R probably benign Het
Gm14326 T C 2: 177,948,481 Y29C probably damaging Het
Gm45713 C T 7: 45,134,002 V147I probably benign Het
Gpr149 C T 3: 62,530,739 D666N probably damaging Het
Gpr183 A G 14: 121,954,740 I123T possibly damaging Het
Il7r A T 15: 9,512,927 H165Q probably damaging Het
Krt73 A G 15: 101,802,045 F85L probably benign Het
Lrrc29 C A 8: 105,315,284 R304L possibly damaging Het
Lrrc8d A G 5: 105,812,791 T356A probably damaging Het
Marco A G 1: 120,494,042 probably null Het
Mettl14 T A 3: 123,383,604 E49D possibly damaging Het
Mrap T A 16: 90,749,222 probably null Het
Mrps34 C T 17: 24,895,878 A152V probably benign Het
Nfasc T A 1: 132,573,773 Y1163F unknown Het
Nfic T C 10: 81,420,500 D110G probably damaging Het
Nip7 T C 8: 107,057,119 V28A possibly damaging Het
Odam T C 5: 87,892,428 F251S possibly damaging Het
Olfm5 T A 7: 104,161,772 Q53L probably null Het
P2ry13 T G 3: 59,210,124 M78L probably benign Het
Pacs1 T C 19: 5,152,699 E385G probably damaging Het
Pip5k1b C T 19: 24,359,979 G315D probably damaging Het
Pla2g4a C A 1: 149,886,271 R145L probably damaging Het
Rars T C 11: 35,828,752 Q81R probably benign Het
Rassf7 A G 7: 141,217,934 N296D probably damaging Het
Rcsd1 C T 1: 165,657,693 A94T probably benign Het
Rgs8 T C 1: 153,690,922 F73S probably damaging Het
Rilpl2 A C 5: 124,477,980 Y36D probably damaging Het
Rpl10l A G 12: 66,284,230 V43A probably benign Het
Sesn2 T C 4: 132,496,889 I403V probably damaging Het
Slc10a4 C T 5: 73,007,110 S15L unknown Het
Slc7a5 T C 8: 121,907,140 Y156C probably damaging Het
Spata18 A G 5: 73,668,665 H105R Het
Specc1l A G 10: 75,245,802 D344G probably damaging Het
Syne1 A G 10: 5,162,461 V415A probably benign Het
Thbs4 T G 13: 92,775,562 D220A probably benign Het
Tmco5 T C 2: 116,886,271 S152P probably benign Het
Tmem35b A T 4: 127,128,941 D125V probably damaging Het
Trim17 A G 11: 58,966,808 E155G possibly damaging Het
Vmn2r11 A C 5: 109,047,615 V615G probably benign Het
Vmn2r88 A T 14: 51,418,449 Q705L Het
Vmn2r93 A G 17: 18,305,321 R414G probably benign Het
Xirp2 T C 2: 67,508,849 L478P probably damaging Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0281:Abcc5 UTSW 16 20422400 missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20333588 missense probably benign 0.01
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20375113 missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 intron probably null
R4433:Abcc5 UTSW 16 20368187 intron probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6815:Abcc5 UTSW 16 20333630 missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
R7167:Abcc5 UTSW 16 20405501 missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20376508 splice site probably null
R7318:Abcc5 UTSW 16 20392543 missense probably benign 0.01
R7380:Abcc5 UTSW 16 20397034 missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20422423 missense possibly damaging 0.57
R7451:Abcc5 UTSW 16 20375070 missense probably damaging 1.00
R7475:Abcc5 UTSW 16 20399989 missense probably benign 0.04
R7567:Abcc5 UTSW 16 20405510 missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20375132 nonsense probably null
R7623:Abcc5 UTSW 16 20344696 missense possibly damaging 0.95
R8128:Abcc5 UTSW 16 20365723 missense probably damaging 0.98
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAAAGGCCAGACTCTGTTCTC -3'
(R):5'- GAATGGATGTCCTGCACAGTG -3'

Sequencing Primer
(F):5'- ACTCTGTTCTCTGTCTTAGGAGAGAC -3'
(R):5'- ATGTCCTGCACAGTGGTCAC -3'
Posted On2019-11-12