Incidental Mutation 'R7683:Olfr427'
ID592855
Institutional Source Beutler Lab
Gene Symbol Olfr427
Ensembl Gene ENSMUSG00000059371
Gene Nameolfactory receptor 427
SynonymsMOR105-7, MOR105-9, GA_x6K02T2P20D-21075927-21074980
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174096891-174103224 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174099476 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 6 (Q6R)
Ref Sequence ENSEMBL: ENSMUSP00000149570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080831] [ENSMUST00000213832]
Predicted Effect probably benign
Transcript: ENSMUST00000080831
AA Change: Q6R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079644
Gene: ENSMUSG00000059371
AA Change: Q6R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.2e-58 PFAM
Pfam:7tm_1 41 289 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213832
AA Change: Q6R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Olfr427
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Olfr427 APN 1 174100367 missense probably benign
IGL01804:Olfr427 APN 1 174099835 missense probably damaging 1.00
IGL02573:Olfr427 APN 1 174100130 missense possibly damaging 0.94
IGL02736:Olfr427 APN 1 174099647 missense probably damaging 0.99
R0012:Olfr427 UTSW 1 174100207 missense probably damaging 1.00
R0437:Olfr427 UTSW 1 174100399 missense probably benign 0.04
R0688:Olfr427 UTSW 1 174100064 missense probably damaging 1.00
R1473:Olfr427 UTSW 1 174099749 missense probably damaging 1.00
R1754:Olfr427 UTSW 1 174100033 missense probably benign 0.24
R5453:Olfr427 UTSW 1 174099467 missense probably benign
R5776:Olfr427 UTSW 1 174099773 missense probably damaging 1.00
R6700:Olfr427 UTSW 1 174099839 missense probably damaging 1.00
R7472:Olfr427 UTSW 1 174099733 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTTCCTAGTAAACATCATGTTCTC -3'
(R):5'- TGAAACTGTACATGGGATTGTGC -3'

Sequencing Primer
(F):5'- TGGAAGTTGCGAAATTGTCATTC -3'
(R):5'- ATTGTGCAGACGGACATCC -3'
Posted On2019-11-12