Mutagenetix > Incidental Mutation

Incidental Mutation 'R7683:Cse1l'

592857

Institutional Source

Beutler Lab

Gene Symbol

Cse1l

Ensembl Gene

ENSMUSG00000002718

Gene Name

chromosome segregation 1-like (S. cerevisiae)

Synonyms

Capts, Xpo2, 2610100P18Rik, Cas

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7683 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

166906040-166946389 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 166922788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 171 (T171S)

Ref Sequence

ENSEMBL: ENSMUSP00000002790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002790] [ENSMUST00000163437] [ENSMUST00000168599] [ENSMUST00000169290]

AlphaFold

Q9ERK4

Predicted Effect

probably benign
Transcript: ENSMUST00000002790
AA Change: T171S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000002790
Gene: ENSMUSG00000002718
AA Change: T171S

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	526	9.2e-169	PFAM
Pfam:CAS_CSE1	527	962	1.1e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163437

SMART Domains

Protein: ENSMUSP00000126757
Gene: ENSMUSG00000002718

Domain	Start	End	E-Value	Type
Pfam:Cse1	1	237	7.9e-105	PFAM
Pfam:CAS_CSE1	225	649	2.3e-195	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168599
AA Change: T171S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129983
Gene: ENSMUSG00000002718
AA Change: T171S

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	256	8.6e-40	PFAM
Pfam:Cse1	255	470	7.3e-99	PFAM
Pfam:CAS_CSE1	471	906	1.3e-201	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169290
AA Change: T171S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000128376
Gene: ENSMUSG00000002718
AA Change: T171S

Domain	Start	End	E-Value	Type
IBN_N	29	102	2e-10	SMART
Pfam:Cse1	156	389	5.2e-102	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that carry a nuclear localization signal (NLS) are transported into the nucleus by the importin-alpha/beta heterodimer. Importin-alpha binds the NLS, while importin-beta mediates translocation through the nuclear pore complex. After translocation, RanGTP binds importin-beta and displaces importin-alpha. Importin-alpha must then be returned to the cytoplasm, leaving the NLS protein behind. The protein encoded by this gene binds strongly to NLS-free importin-alpha, and this binding is released in the cytoplasm by the combined action of RANBP1 and RANGAP1. In addition, the encoded protein may play a role both in apoptosis and in cell proliferation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Embryos homozygous for a targeted null mutation die prior to E5.5 of development and are morphologically disorganized and lack identifiable structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtpbp1	A	G	13: 59,512,498	C305R	probably damaging	Het
Anpep	C	A	7: 79,839,198	V381L	probably damaging	Het
Ap5s1	T	C	2: 131,212,707	L146P	probably damaging	Het
Arhgef11	A	G	3: 87,722,383	I599V	probably damaging	Het
Arpc2	T	C	1: 74,263,814	Y250H	probably damaging	Het
Baz1b	T	A	5: 135,217,728	M677K	probably damaging	Het
Begain	C	T	12: 109,033,487	A453T	unknown	Het
C1ql4	T	C	15: 99,087,211	D173G	probably benign	Het
Card11	T	G	5: 140,896,026	N461T	probably benign	Het
Ccdc9	T	C	7: 16,284,362	D7G	probably damaging	Het
Ces2a	T	C	8: 104,737,112	V152A	probably benign	Het
Chl1	G	A	6: 103,691,652	A449T	possibly damaging	Het
Col11a1	G	T	3: 114,113,736	G638W	unknown	Het
D2hgdh	T	A	1: 93,838,965		probably null	Het
Dlg4	T	C	11: 70,039,854	Y432H	possibly damaging	Het
Dmwd	C	T	7: 19,080,735	L437F	probably damaging	Het
F11	T	A	8: 45,249,508	Q251L	probably damaging	Het
Gm13078	A	T	4: 143,726,714	K131*	probably null	Het
Gtf2f1	T	A	17: 57,005,458	E195V	possibly damaging	Het
Hap1	A	T	11: 100,351,548	L376Q	probably damaging	Het
Hars2	T	A	18: 36,788,236	I234N	probably damaging	Het
Hcfc2	T	C	10: 82,699,229	V29A	probably benign	Het
Hp	C	T	8: 109,579,099		probably benign	Het
Hrh1	T	C	6: 114,479,787	S10P	probably benign	Het
Kcnmb2	A	G	3: 32,198,316	Y222C	probably damaging	Het
Kdm3a	A	G	6: 71,599,454	V792A	probably benign	Het
Kif13b	G	A	14: 64,757,507	V903I	probably benign	Het
Lars2	G	T	9: 123,377,830		probably null	Het
Med7	A	G	11: 46,440,860	D94G	possibly damaging	Het
Mier3	A	G	13: 111,705,312	T136A	probably benign	Het
Nin	T	C	12: 70,078,182	E122G		Het
Olfr186	G	T	16: 59,027,106	T267K	probably benign	Het
Olfr427	A	G	1: 174,099,476	Q6R	probably benign	Het
Oxsr1	T	C	9: 119,241,755	I489V	probably benign	Het
Pdcd6ip	A	T	9: 113,687,695	L216Q	probably damaging	Het
Ppp4r4	T	A	12: 103,587,105	C379*	probably null	Het
Ptpn13	T	A	5: 103,565,152	C1714S	probably benign	Het
Pum2	G	A	12: 8,728,922	R498Q	possibly damaging	Het
Sema3d	T	A	5: 12,573,856	Y577*	probably null	Het
Slc29a3	G	A	10: 60,716,366	P300S	not run	Het
Slc5a4b	A	G	10: 76,064,072	V444A	probably damaging	Het
Smad9	A	G	3: 54,789,264	E250G	probably damaging	Het
Srsf7	A	G	17: 80,207,274		probably benign	Het
Thsd7b	A	G	1: 129,595,946	Y239C	probably damaging	Het
Triml2	C	A	8: 43,185,288	Q98K	probably damaging	Het
Txndc11	A	T	16: 11,084,235	L705Q	probably damaging	Het
Vmn1r22	A	G	6: 57,900,419	M191T	probably damaging	Het
Vmn2r89	A	T	14: 51,455,194	K151N	probably benign	Het
Vwa5a	A	G	9: 38,734,829	I498V	probably damaging	Het
Zfp459	T	C	13: 67,408,496	H156R	probably damaging	Het
Zscan18	T	A	7: 12,769,605	K676*	probably null	Het

Other mutations in Cse1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Cse1l	APN	2	166927804	missense	probably damaging	1.00
IGL01306:Cse1l	APN	2	166927508	nonsense	probably null
IGL01672:Cse1l	APN	2	166929967	missense	probably damaging	1.00
IGL02060:Cse1l	APN	2	166930653	missense	probably damaging	1.00
IGL02897:Cse1l	APN	2	166919708	missense	possibly damaging	0.47
IGL03375:Cse1l	APN	2	166943057	splice site	probably benign
ANU23:Cse1l	UTSW	2	166927508	nonsense	probably null
PIT4585001:Cse1l	UTSW	2	166941474	missense	probably damaging	1.00
R0195:Cse1l	UTSW	2	166940088	missense	probably benign
R1114:Cse1l	UTSW	2	166941203	splice site	probably benign
R1539:Cse1l	UTSW	2	166926372	missense	probably benign	0.00
R1721:Cse1l	UTSW	2	166926411	missense	probably damaging	1.00
R1779:Cse1l	UTSW	2	166940124	splice site	probably null
R1913:Cse1l	UTSW	2	166922191	missense	probably damaging	1.00
R2069:Cse1l	UTSW	2	166941492	missense	probably benign	0.01
R2398:Cse1l	UTSW	2	166928997	missense	probably damaging	1.00
R4110:Cse1l	UTSW	2	166942050	missense	probably benign	0.00
R4195:Cse1l	UTSW	2	166929979	missense	probably damaging	1.00
R4603:Cse1l	UTSW	2	166944532	missense	probably benign	0.09
R4686:Cse1l	UTSW	2	166932160	missense	probably damaging	1.00
R4867:Cse1l	UTSW	2	166926403	missense	possibly damaging	0.76
R4942:Cse1l	UTSW	2	166929794	missense	probably damaging	1.00
R5164:Cse1l	UTSW	2	166944428	missense	probably benign	0.02
R5475:Cse1l	UTSW	2	166941254	missense	probably damaging	1.00
R5493:Cse1l	UTSW	2	166941190	intron	probably benign
R5782:Cse1l	UTSW	2	166929001	missense	probably damaging	1.00
R5862:Cse1l	UTSW	2	166915207	missense	probably benign	0.00
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6030:Cse1l	UTSW	2	166919621	missense	probably benign	0.01
R6913:Cse1l	UTSW	2	166929877	missense	possibly damaging	0.65
R7871:Cse1l	UTSW	2	166935671	splice site	probably null
R8001:Cse1l	UTSW	2	166939913	missense	probably damaging	1.00
R8057:Cse1l	UTSW	2	166939925	missense	probably damaging	1.00
R8175:Cse1l	UTSW	2	166943208	critical splice donor site	probably null
R8347:Cse1l	UTSW	2	166927585	missense	possibly damaging	0.95
R8386:Cse1l	UTSW	2	166919684	missense	probably benign	0.00
R8479:Cse1l	UTSW	2	166921973	missense	possibly damaging	0.95
R8973:Cse1l	UTSW	2	166943080	missense	probably damaging	1.00
R9206:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9208:Cse1l	UTSW	2	166941265	missense	probably damaging	1.00
R9522:Cse1l	UTSW	2	166934753	missense	probably benign
R9599:Cse1l	UTSW	2	166941466	missense	probably benign
R9600:Cse1l	UTSW	2	166915199	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGCCTCTGGTTGAAGGTG -3'
(R):5'- CTCAAGAGGCTGCAGAGATG -3'

Sequencing Primer
(F):5'- TAGCTGTCTTCAGATGCACCAGAAG -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'

Posted On

2019-11-12