Incidental Mutation 'R7683:Kcnmb2'
ID592858
Institutional Source Beutler Lab
Gene Symbol Kcnmb2
Ensembl Gene ENSMUSG00000037610
Gene Namepotassium large conductance calcium-activated channel, subfamily M, beta member 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location31902507-32200180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32198316 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 222 (Y222C)
Ref Sequence ENSEMBL: ENSMUSP00000141656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119310] [ENSMUST00000119970] [ENSMUST00000178668] [ENSMUST00000191869] [ENSMUST00000192429] [ENSMUST00000194796]
Predicted Effect probably damaging
Transcript: ENSMUST00000119310
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112531
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 4.5e-22 PFAM
Pfam:CaKB 38 229 3e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119970
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113234
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 3.7e-26 PFAM
Pfam:CaKB 33 230 9.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178668
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136596
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 3.7e-26 PFAM
Pfam:CaKB 33 230 9.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191869
SMART Domains Protein: ENSMUSP00000141955
Gene: ENSMUSG00000037610

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 1.9e-22 PFAM
Pfam:CaKB 33 162 9.3e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192429
AA Change: Y222C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141656
Gene: ENSMUSG00000037610
AA Change: Y222C

DomainStartEndE-ValueType
Pfam:KcnmB2_inactiv 1 32 3.7e-26 PFAM
Pfam:CaKB 33 230 9.6e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194796
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which decreases the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants of this gene. Additional variants are discussed in the literature, but their full length nature has not been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene abolishes inactivation of BK currents in mouse adrenal chromaffin cells and results in slow-wave burst activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Kcnmb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01909:Kcnmb2 APN 3 32198363 unclassified probably benign
IGL02153:Kcnmb2 APN 3 32178844 missense probably damaging 1.00
IGL02211:Kcnmb2 APN 3 32198334 missense probably damaging 1.00
IGL03019:Kcnmb2 APN 3 32198150 missense probably damaging 1.00
IGL03095:Kcnmb2 APN 3 32198127 makesense probably null
R0334:Kcnmb2 UTSW 3 32198359 unclassified probably null
R1781:Kcnmb2 UTSW 3 32179003 critical splice donor site probably null
R2064:Kcnmb2 UTSW 3 32198288 missense probably damaging 0.99
R3858:Kcnmb2 UTSW 3 32198301 missense probably damaging 1.00
R4371:Kcnmb2 UTSW 3 32156102 unclassified probably null
R4766:Kcnmb2 UTSW 3 32181867 missense probably damaging 1.00
R5493:Kcnmb2 UTSW 3 32198142 missense probably damaging 0.97
R6063:Kcnmb2 UTSW 3 32178992 missense probably damaging 1.00
R6240:Kcnmb2 UTSW 3 32181896 missense probably damaging 1.00
R6928:Kcnmb2 UTSW 3 32199041 missense probably benign 0.05
R6939:Kcnmb2 UTSW 3 32198316 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTCCATGTCTCTCGTG -3'
(R):5'- AGGACAGCGTTTGCATTATTG -3'

Sequencing Primer
(F):5'- CTCGTGAGTGTCGTCATGGAAAAC -3'
(R):5'- GTTCTTTGGTGAAGAACGAA -3'
Posted On2019-11-12