Incidental Mutation 'R7683:Sema3d'
ID592863
Institutional Source Beutler Lab
Gene Symbol Sema3d
Ensembl Gene ENSMUSG00000040254
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D
Synonyms4631426B19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location12383385-12588948 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 12573856 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 577 (Y577*)
Ref Sequence ENSEMBL: ENSMUSP00000030868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030868] [ENSMUST00000197927]
Predicted Effect probably null
Transcript: ENSMUST00000030868
AA Change: Y577*
SMART Domains Protein: ENSMUSP00000030868
Gene: ENSMUSG00000040254
AA Change: Y577*

DomainStartEndE-ValueType
transmembrane domain 16 35 N/A INTRINSIC
Sema 70 515 2.97e-207 SMART
PSI 533 585 2.03e-13 SMART
IG 598 682 1.39e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197927
AA Change: Y577*
SMART Domains Protein: ENSMUSP00000142453
Gene: ENSMUSG00000040254
AA Change: Y577*

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Sema 70 515 1e-209 SMART
PSI 533 585 8.5e-16 SMART
Blast:Sema 590 622 1e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin like domain and a C-terminal basic domain. The protein encoded by this gene binds neuropilin and plays an important role in cardiovascular development. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit pulmonary vein connection to the right atrium and atrial septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Sema3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3d APN 5 12563222 missense probably benign 0.01
IGL00582:Sema3d APN 5 12585195 missense probably damaging 1.00
IGL00661:Sema3d APN 5 12505839 missense probably damaging 1.00
IGL00780:Sema3d APN 5 12524326 missense probably damaging 1.00
IGL01531:Sema3d APN 5 12541080 missense probably benign
IGL01957:Sema3d APN 5 12563315 missense probably damaging 1.00
IGL02100:Sema3d APN 5 12584991 missense probably benign 0.29
IGL02676:Sema3d APN 5 12570978 missense probably benign 0.38
IGL02749:Sema3d APN 5 12563145 splice site probably benign
IGL02827:Sema3d APN 5 12585118 missense probably benign 0.04
IGL03325:Sema3d APN 5 12463222 missense probably damaging 0.99
R0050:Sema3d UTSW 5 12584953 missense probably benign 0.00
R0085:Sema3d UTSW 5 12570986 missense probably benign 0.00
R0095:Sema3d UTSW 5 12563347 missense probably damaging 1.00
R0157:Sema3d UTSW 5 12508137 missense possibly damaging 0.95
R0328:Sema3d UTSW 5 12448075 missense possibly damaging 0.48
R0924:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R0930:Sema3d UTSW 5 12463216 missense possibly damaging 0.69
R1609:Sema3d UTSW 5 12541056 missense probably damaging 1.00
R1657:Sema3d UTSW 5 12584974 missense possibly damaging 0.82
R1669:Sema3d UTSW 5 12508084 splice site probably benign
R1795:Sema3d UTSW 5 12584887 missense probably benign 0.02
R1861:Sema3d UTSW 5 12497603 missense probably benign 0.00
R1889:Sema3d UTSW 5 12485021 splice site probably null
R1895:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1946:Sema3d UTSW 5 12573843 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12563318 missense probably damaging 1.00
R1975:Sema3d UTSW 5 12584998 missense probably benign
R2117:Sema3d UTSW 5 12563273 missense probably benign
R2148:Sema3d UTSW 5 12484959 missense probably damaging 0.99
R2276:Sema3d UTSW 5 12542582 missense possibly damaging 0.63
R3761:Sema3d UTSW 5 12571037 missense probably damaging 1.00
R4063:Sema3d UTSW 5 12585124 missense probably benign 0.25
R4428:Sema3d UTSW 5 12448120 missense probably benign 0.32
R4903:Sema3d UTSW 5 12563158 missense probably benign 0.00
R4999:Sema3d UTSW 5 12508087 splice site probably null
R5000:Sema3d UTSW 5 12448038 missense probably benign 0.01
R5022:Sema3d UTSW 5 12584956 missense probably damaging 1.00
R5186:Sema3d UTSW 5 12584908 missense probably benign
R5584:Sema3d UTSW 5 12566008 missense possibly damaging 0.49
R5584:Sema3d UTSW 5 12570987 missense possibly damaging 0.73
R6270:Sema3d UTSW 5 12448107 missense probably benign
R6368:Sema3d UTSW 5 12571013 missense probably damaging 1.00
R6426:Sema3d UTSW 5 12563264 missense probably damaging 1.00
R6750:Sema3d UTSW 5 12585100 nonsense probably null
R7403:Sema3d UTSW 5 12497584 missense probably damaging 0.97
R7450:Sema3d UTSW 5 12584934 nonsense probably null
R7470:Sema3d UTSW 5 12508185 missense probably damaging 1.00
R7548:Sema3d UTSW 5 12577816 missense unknown
R7593:Sema3d UTSW 5 12508145 missense probably benign 0.02
Z1176:Sema3d UTSW 5 12585059 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGATCATCTTAATGCAAGACAGG -3'
(R):5'- CCTGTTACTTTTCTAGAACATACGC -3'

Sequencing Primer
(F):5'- TCATCTTAATGCAAGACAGGATTTG -3'
(R):5'- AGAACATACGCATTATACAGAATGAG -3'
Posted On2019-11-12