Incidental Mutation 'R7683:Vmn1r22'
ID592867
Institutional Source Beutler Lab
Gene Symbol Vmn1r22
Ensembl Gene ENSMUSG00000115091
Gene Namevomeronasal 1 receptor 22
SynonymsV1rc23
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location57898126-57908028 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57900419 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 191 (M191T)
Ref Sequence ENSEMBL: ENSMUSP00000153802 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000227342
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227650
AA Change: M191T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228076
AA Change: M191T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228257
AA Change: M191T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228322
AA Change: M191T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000228905
AA Change: M1T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Vmn1r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Vmn1r22 UTSW 6 57900528 missense probably benign 0.06
R0415:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
R1132:Vmn1r22 UTSW 6 57900841 missense probably benign 0.43
R1609:Vmn1r22 UTSW 6 57900748 nonsense probably null
R1666:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1668:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1708:Vmn1r22 UTSW 6 57900496 missense possibly damaging 0.46
R1796:Vmn1r22 UTSW 6 57900149 missense probably damaging 1.00
R2359:Vmn1r22 UTSW 6 57900989 start codon destroyed probably null 1.00
R4600:Vmn1r22 UTSW 6 57900875 missense probably damaging 1.00
R5302:Vmn1r22 UTSW 6 57900975 missense possibly damaging 0.87
R5560:Vmn1r22 UTSW 6 57900738 missense probably damaging 1.00
R6026:Vmn1r22 UTSW 6 57900405 missense probably benign 0.00
R6066:Vmn1r22 UTSW 6 57900879 missense probably benign 0.01
R6343:Vmn1r22 UTSW 6 57900578 missense possibly damaging 0.65
R6639:Vmn1r22 UTSW 6 57900714 missense probably benign 0.01
R7106:Vmn1r22 UTSW 6 57900311 missense probably damaging 1.00
S24628:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGGATGAGATGATGAGGTCCAC -3'
(R):5'- CCTCACTGTTGGCAAAATTTAAGC -3'

Sequencing Primer
(F):5'- TGATGAGGTCCACCCAGTACATG -3'
(R):5'- ACTGTTGGCAAAATTTAAGCATAAAC -3'
Posted On2019-11-12