Incidental Mutation 'R7683:Zscan18'
ID592871
Institutional Source Beutler Lab
Gene Symbol Zscan18
Ensembl Gene ENSMUSG00000070822
Gene Namezinc finger and SCAN domain containing 18
SynonymsEG232875
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12768090-12803635 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 12769605 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 676 (K676*)
Ref Sequence ENSEMBL: ENSMUSP00000047088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046245] [ENSMUST00000210650] [ENSMUST00000211392]
Predicted Effect probably null
Transcript: ENSMUST00000046245
AA Change: K676*
SMART Domains Protein: ENSMUSP00000047088
Gene: ENSMUSG00000070822
AA Change: K676*

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 134 154 N/A INTRINSIC
internal_repeat_2 159 204 6.76e-5 PROSPERO
internal_repeat_1 197 221 2.66e-6 PROSPERO
low complexity region 225 256 N/A INTRINSIC
low complexity region 262 310 N/A INTRINSIC
low complexity region 312 335 N/A INTRINSIC
internal_repeat_1 353 377 2.66e-6 PROSPERO
SCAN 397 509 1.16e-37 SMART
ZnF_C2H2 776 798 2.24e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210650
AA Change: K676*
Predicted Effect probably benign
Transcript: ENSMUST00000210891
Predicted Effect probably null
Transcript: ENSMUST00000211392
AA Change: K676*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Other mutations in Zscan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Zscan18 APN 7 12775348 unclassified probably benign
IGL02152:Zscan18 APN 7 12775296 unclassified probably benign
IGL02236:Zscan18 APN 7 12769324 missense probably benign 0.02
IGL02591:Zscan18 APN 7 12775279 unclassified probably benign
IGL02619:Zscan18 APN 7 12774866 unclassified probably benign
IGL02711:Zscan18 APN 7 12775117 unclassified probably benign
IGL03397:Zscan18 APN 7 12773561 missense probably damaging 0.97
R0014:Zscan18 UTSW 7 12769417 missense possibly damaging 0.48
R0465:Zscan18 UTSW 7 12775486 unclassified probably benign
R0548:Zscan18 UTSW 7 12774176 missense probably damaging 1.00
R1506:Zscan18 UTSW 7 12774202 missense probably damaging 1.00
R1725:Zscan18 UTSW 7 12770857 missense probably damaging 1.00
R2323:Zscan18 UTSW 7 12775459 unclassified probably benign
R5034:Zscan18 UTSW 7 12774145 missense probably damaging 1.00
R5180:Zscan18 UTSW 7 12775289 unclassified probably benign
R5579:Zscan18 UTSW 7 12775381 unclassified probably benign
R5635:Zscan18 UTSW 7 12770864 missense probably benign 0.00
R5708:Zscan18 UTSW 7 12774456 missense probably benign 0.01
R6088:Zscan18 UTSW 7 12775198 unclassified probably benign
R6320:Zscan18 UTSW 7 12775220 unclassified probably benign
R7048:Zscan18 UTSW 7 12774744 unclassified probably benign
R7610:Zscan18 UTSW 7 12769310 missense probably damaging 0.98
RF055:Zscan18 UTSW 7 12774425 small deletion probably benign
Z1088:Zscan18 UTSW 7 12775067 missense probably benign 0.18
Z1088:Zscan18 UTSW 7 12775093 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCTGCCCAGAATCATGAC -3'
(R):5'- GACTGCTCACATTGTGACTTTG -3'

Sequencing Primer
(F):5'- CTGCATCAAATGGCAGCTG -3'
(R):5'- TTGTTTCAGACAGCACCAGG -3'
Posted On2019-11-12