Incidental Mutation 'R7683:Vwa5a'
ID592879
Institutional Source Beutler Lab
Gene Symbol Vwa5a
Ensembl Gene ENSMUSG00000023186
Gene Namevon Willebrand factor A domain containing 5A
SynonymsLoh11cr2a, 5830475I06Rik, BCSC-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38718268-38743337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38734829 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 498 (I498V)
Ref Sequence ENSEMBL: ENSMUSP00000001544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001544] [ENSMUST00000118144]
Predicted Effect probably damaging
Transcript: ENSMUST00000001544
AA Change: I498V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000001544
Gene: ENSMUSG00000023186
AA Change: I498V

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118144
AA Change: I498V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113596
Gene: ENSMUSG00000023186
AA Change: I498V

DomainStartEndE-ValueType
VIT 1 131 2.59e-61 SMART
VWA 279 460 2.61e-12 SMART
low complexity region 615 629 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
Blast:VWA 681 713 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137972
SMART Domains Protein: ENSMUSP00000121104
Gene: ENSMUSG00000023186

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 45 59 N/A INTRINSIC
Blast:VWA 62 94 2e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Vwa5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vwa5a APN 9 38737814 splice site probably null
IGL00966:Vwa5a APN 9 38723379 missense probably benign 0.24
IGL01597:Vwa5a APN 9 38733865 missense probably damaging 1.00
IGL01950:Vwa5a APN 9 38726970 missense probably damaging 1.00
IGL02008:Vwa5a APN 9 38737776 missense probably benign 0.08
IGL02326:Vwa5a APN 9 38737956 missense probably benign
IGL02378:Vwa5a APN 9 38733970 missense probably benign 0.41
IGL02442:Vwa5a APN 9 38734784 missense probably benign 0.02
IGL02458:Vwa5a APN 9 38726963 missense possibly damaging 0.79
IGL02570:Vwa5a APN 9 38734871 unclassified probably benign
IGL03068:Vwa5a APN 9 38734847 missense probably benign 0.45
R0126:Vwa5a UTSW 9 38737807 splice site probably null
R0325:Vwa5a UTSW 9 38728665 missense probably damaging 1.00
R0617:Vwa5a UTSW 9 38723895 missense probably damaging 1.00
R0928:Vwa5a UTSW 9 38728007 missense probably damaging 1.00
R1334:Vwa5a UTSW 9 38734741 missense probably benign 0.01
R1446:Vwa5a UTSW 9 38733968 missense possibly damaging 0.95
R1708:Vwa5a UTSW 9 38727832 missense probably benign
R1986:Vwa5a UTSW 9 38737814 splice site probably benign
R2024:Vwa5a UTSW 9 38736061 missense probably damaging 0.98
R2230:Vwa5a UTSW 9 38733878 missense probably null 1.00
R2252:Vwa5a UTSW 9 38728080 missense probably damaging 1.00
R2278:Vwa5a UTSW 9 38723207 missense probably damaging 1.00
R3912:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R3913:Vwa5a UTSW 9 38734743 missense probably damaging 0.97
R4172:Vwa5a UTSW 9 38723870 missense probably damaging 0.98
R4244:Vwa5a UTSW 9 38737816 splice site probably benign
R4510:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4511:Vwa5a UTSW 9 38722557 missense possibly damaging 0.60
R4549:Vwa5a UTSW 9 38737925 missense probably benign 0.09
R4591:Vwa5a UTSW 9 38735620 missense possibly damaging 0.94
R4639:Vwa5a UTSW 9 38727114 critical splice donor site probably null
R4811:Vwa5a UTSW 9 38735953 missense probably benign 0.00
R4911:Vwa5a UTSW 9 38737972 missense probably benign 0.03
R4936:Vwa5a UTSW 9 38736198 missense probably benign 0.00
R4989:Vwa5a UTSW 9 38722630 missense probably benign 0.40
R5370:Vwa5a UTSW 9 38741216 missense probably benign 0.02
R5596:Vwa5a UTSW 9 38722578 missense probably damaging 1.00
R5914:Vwa5a UTSW 9 38741742 missense probably benign 0.00
R6207:Vwa5a UTSW 9 38722672 missense probably damaging 1.00
R6486:Vwa5a UTSW 9 38733878 missense probably null 1.00
R7666:Vwa5a UTSW 9 38733963 missense probably benign 0.06
R7763:Vwa5a UTSW 9 38741162 missense possibly damaging 0.93
R7839:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7922:Vwa5a UTSW 9 38723503 missense probably damaging 0.98
R7996:Vwa5a UTSW 9 38727828 nonsense probably null
R8024:Vwa5a UTSW 9 38736020 nonsense probably null
X0022:Vwa5a UTSW 9 38735962 missense probably damaging 1.00
X0067:Vwa5a UTSW 9 38723251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTATGCCCTACTTCCTGATAAATATC -3'
(R):5'- TTAGCCATGGCACCCAAGAG -3'

Sequencing Primer
(F):5'- CCTGATAAATATCCAATGAATGCTGG -3'
(R):5'- CAAGTGACCACCAAGTGTT -3'
Posted On2019-11-12