Incidental Mutation 'R7683:Pdcd6ip'
ID592880
Institutional Source Beutler Lab
Gene Symbol Pdcd6ip
Ensembl Gene ENSMUSG00000032504
Gene Nameprogrammed cell death 6 interacting protein
SynonymsAlix, AIP1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location113651744-113708259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113687695 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 216 (L216Q)
Ref Sequence ENSEMBL: ENSMUSP00000107492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]
Predicted Effect probably damaging
Transcript: ENSMUST00000035086
AA Change: L216Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: L216Q

DomainStartEndE-ValueType
BRO1 3 382 1.99e-160 SMART
Pfam:ALIX_LYPXL_bnd 408 702 3.6e-91 PFAM
low complexity region 731 812 N/A INTRINSIC
Blast:BRO1 813 839 2e-11 BLAST
low complexity region 840 869 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111861
AA Change: L216Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: L216Q

DomainStartEndE-ValueType
BRO1 3 387 3.46e-160 SMART
Pfam:ALIX_LYPXL_bnd 417 706 8.8e-96 PFAM
low complexity region 736 817 N/A INTRINSIC
Blast:BRO1 818 844 2e-11 BLAST
low complexity region 845 874 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Pdcd6ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Pdcd6ip APN 9 113697518 missense possibly damaging 0.89
IGL00814:Pdcd6ip APN 9 113687653 missense probably damaging 0.97
IGL01092:Pdcd6ip APN 9 113680181 splice site probably benign
IGL01621:Pdcd6ip APN 9 113685422 missense probably benign 0.03
IGL01781:Pdcd6ip APN 9 113691498 missense probably damaging 1.00
IGL02158:Pdcd6ip APN 9 113680053 nonsense probably null
IGL03136:Pdcd6ip APN 9 113691499 missense probably damaging 1.00
IGL03137:Pdcd6ip APN 9 113657145 missense possibly damaging 0.69
IGL03246:Pdcd6ip APN 9 113678417 missense possibly damaging 0.93
R0230:Pdcd6ip UTSW 9 113685293 splice site probably benign
R0284:Pdcd6ip UTSW 9 113662504 missense probably damaging 1.00
R0862:Pdcd6ip UTSW 9 113674510 splice site probably benign
R0864:Pdcd6ip UTSW 9 113674510 splice site probably benign
R1025:Pdcd6ip UTSW 9 113662286 missense probably damaging 1.00
R1687:Pdcd6ip UTSW 9 113700019 missense probably damaging 1.00
R1699:Pdcd6ip UTSW 9 113678354 missense probably damaging 1.00
R1957:Pdcd6ip UTSW 9 113708022 missense probably damaging 1.00
R2317:Pdcd6ip UTSW 9 113672774 missense probably benign 0.03
R2698:Pdcd6ip UTSW 9 113674507 splice site probably null
R4182:Pdcd6ip UTSW 9 113700010 missense probably benign 0.00
R5154:Pdcd6ip UTSW 9 113691542 missense probably damaging 1.00
R5229:Pdcd6ip UTSW 9 113678333 missense probably damaging 0.99
R5391:Pdcd6ip UTSW 9 113691518 missense probably damaging 1.00
R5972:Pdcd6ip UTSW 9 113662298 missense probably benign 0.07
R6149:Pdcd6ip UTSW 9 113659871 missense probably benign 0.03
R6406:Pdcd6ip UTSW 9 113674344 missense possibly damaging 0.81
R6514:Pdcd6ip UTSW 9 113689694 missense probably benign 0.43
R6869:Pdcd6ip UTSW 9 113655106 missense unknown
R6888:Pdcd6ip UTSW 9 113671837 missense probably benign 0.04
R7078:Pdcd6ip UTSW 9 113659885 missense probably benign 0.01
Z1177:Pdcd6ip UTSW 9 113685369 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGAAAGAGTTTCAGCTCAGG -3'
(R):5'- TGTGCCACGTCATGTATCGG -3'

Sequencing Primer
(F):5'- GTTTCAGCTCAGGAAAAGAAGTTC -3'
(R):5'- CCACGTCATGTATCGGGTTATGTC -3'
Posted On2019-11-12