Incidental Mutation 'R7683:Lars2'
ID592882
Institutional Source Beutler Lab
Gene Symbol Lars2
Ensembl Gene ENSMUSG00000035202
Gene Nameleucyl-tRNA synthetase, mitochondrial
SynonymsKiaa0028
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location123366927-123462666 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 123377830 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038863] [ENSMUST00000216843] [ENSMUST00000217116]
Predicted Effect probably null
Transcript: ENSMUST00000038863
SMART Domains Protein: ENSMUSP00000036710
Gene: ENSMUSG00000035202

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 57 223 7.6e-24 PFAM
Pfam:tRNA-synt_1g 83 239 9.3e-20 PFAM
Pfam:tRNA-synt_1_2 269 430 1.1e-8 PFAM
Pfam:tRNA-synt_1 434 609 5.6e-8 PFAM
Pfam:tRNA-synt_1g 589 682 1.2e-6 PFAM
Pfam:tRNA-synt_1 633 678 1.6e-7 PFAM
Pfam:Anticodon_1 724 867 9.2e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215464
Predicted Effect probably benign
Transcript: ENSMUST00000216843
Predicted Effect probably benign
Transcript: ENSMUST00000217116
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, mitochondrial leucyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Lars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Lars2 APN 9 123453248 missense probably damaging 0.98
IGL01993:Lars2 APN 9 123394943 splice site probably benign
IGL02155:Lars2 APN 9 123454982 missense probably damaging 0.99
IGL02941:Lars2 APN 9 123459585 missense probably damaging 0.97
IGL03090:Lars2 APN 9 123455960 missense probably damaging 1.00
IGL03271:Lars2 APN 9 123459484 splice site probably null
IGL03386:Lars2 APN 9 123453390 nonsense probably null
IGL03410:Lars2 APN 9 123418776 missense possibly damaging 0.87
ulrich UTSW 9 123418693 missense probably damaging 0.99
K3955:Lars2 UTSW 9 123377777 missense probably damaging 1.00
P0038:Lars2 UTSW 9 123377777 missense probably damaging 1.00
R0276:Lars2 UTSW 9 123438121 splice site probably benign
R1671:Lars2 UTSW 9 123418279 missense probably benign 0.02
R1829:Lars2 UTSW 9 123431917 missense probably benign 0.00
R2219:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R2220:Lars2 UTSW 9 123418780 missense probably damaging 0.98
R4610:Lars2 UTSW 9 123418693 missense probably damaging 0.99
R5027:Lars2 UTSW 9 123441495 missense probably benign 0.38
R5195:Lars2 UTSW 9 123453310 missense probably damaging 0.97
R5597:Lars2 UTSW 9 123454982 missense probably damaging 0.99
R5756:Lars2 UTSW 9 123438199 missense probably damaging 1.00
R5783:Lars2 UTSW 9 123461596 missense probably benign
R6045:Lars2 UTSW 9 123371988 missense probably damaging 1.00
R6235:Lars2 UTSW 9 123411880 missense probably damaging 1.00
R6323:Lars2 UTSW 9 123441594 nonsense probably null
R6377:Lars2 UTSW 9 123454760 missense probably benign 0.00
R6395:Lars2 UTSW 9 123371925 missense probably benign 0.06
R7094:Lars2 UTSW 9 123459585 missense probably damaging 0.99
R7144:Lars2 UTSW 9 123431993 missense probably damaging 1.00
R7233:Lars2 UTSW 9 123411954 nonsense probably null
R7254:Lars2 UTSW 9 123454963 missense possibly damaging 0.93
R7350:Lars2 UTSW 9 123427480 missense probably damaging 1.00
R7413:Lars2 UTSW 9 123459503 missense probably benign 0.30
R7614:Lars2 UTSW 9 123395111 missense
R8000:Lars2 UTSW 9 123436244 missense probably damaging 1.00
R8061:Lars2 UTSW 9 123459497 missense probably benign
Z1177:Lars2 UTSW 9 123454782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATACAGAGATCCCAGAAAATATG -3'
(R):5'- GAAAGGAGCAGTGTTACCCG -3'

Sequencing Primer
(F):5'- CCATACCCTTCTGGCAAG -3'
(R):5'- AGCGTAACATCTACCTCTTGCAG -3'
Posted On2019-11-12