Incidental Mutation 'R7683:Hap1'
ID592888
Institutional Source Beutler Lab
Gene Symbol Hap1
Ensembl Gene ENSMUSG00000006930
Gene Namehuntingtin-associated protein 1
SynonymsHAP-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100347327-100356128 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100351548 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 376 (L376Q)
Ref Sequence ENSEMBL: ENSMUSP00000099413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103124] [ENSMUST00000138603] [ENSMUST00000146878] [ENSMUST00000174635]
Predicted Effect probably damaging
Transcript: ENSMUST00000103124
AA Change: L376Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099413
Gene: ENSMUSG00000006930
AA Change: L376Q

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 79 403 5e-111 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138603
AA Change: L376Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133356
Gene: ENSMUSG00000006930
AA Change: L376Q

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:HAP1_N 80 402 1.4e-109 PFAM
low complexity region 481 499 N/A INTRINSIC
low complexity region 506 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146878
SMART Domains Protein: ENSMUSP00000134625
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
Pfam:HAP1_N 1 181 2.2e-63 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000134050
Gene: ENSMUSG00000006930
AA Change: L150Q

DomainStartEndE-ValueType
Pfam:HAP1_N 1 177 1e-46 PFAM
low complexity region 250 268 N/A INTRINSIC
low complexity region 275 299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174635
SMART Domains Protein: ENSMUSP00000133831
Gene: ENSMUSG00000006930

DomainStartEndE-ValueType
low complexity region 119 137 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene was first identified as a neuronal protein that binds the HD protein huntingtin. The protein also interacts with kinesin light chain, 14-3-3 proteins, and Abelson helper integration site 1 protein. The protein is involved in intracellular trafficking of vesicles and organelles, and lack of the protein results in neuronal death resembling the hypothalamic degeneration that occurs in Huntington's disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene results in abnormal feeding and/or suckling behavior, absent gastric milk in neonates, slow postnatal weight gain, and postnatal death. Degeneration in hypothalamic regions that control feeding behavior has been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Hap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Hap1 APN 11 100349548 missense probably benign 0.00
IGL01320:Hap1 APN 11 100349380 missense probably damaging 0.96
IGL01790:Hap1 APN 11 100351906 unclassified probably null
IGL01949:Hap1 APN 11 100348762 missense probably damaging 0.96
IGL02325:Hap1 APN 11 100354364 critical splice acceptor site probably null
IGL03399:Hap1 APN 11 100354267 missense possibly damaging 0.90
R0346:Hap1 UTSW 11 100356029 missense probably benign
R0463:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R0608:Hap1 UTSW 11 100349305 missense probably damaging 1.00
R1112:Hap1 UTSW 11 100354317 missense probably damaging 1.00
R1682:Hap1 UTSW 11 100349476 missense possibly damaging 0.46
R1952:Hap1 UTSW 11 100352279 missense probably damaging 1.00
R2079:Hap1 UTSW 11 100353746 missense probably damaging 1.00
R2088:Hap1 UTSW 11 100356002 missense probably benign
R2112:Hap1 UTSW 11 100353999 missense probably benign 0.28
R2211:Hap1 UTSW 11 100354724 missense probably benign 0.21
R2354:Hap1 UTSW 11 100354715 missense probably damaging 1.00
R3829:Hap1 UTSW 11 100356021 missense probably damaging 0.99
R4259:Hap1 UTSW 11 100351842 critical splice donor site probably null
R4429:Hap1 UTSW 11 100354272 missense probably benign 0.00
R4585:Hap1 UTSW 11 100354724 missense probably benign 0.21
R4586:Hap1 UTSW 11 100354724 missense probably benign 0.21
R5085:Hap1 UTSW 11 100355711 missense probably damaging 1.00
R5133:Hap1 UTSW 11 100351531 missense probably benign 0.00
R5762:Hap1 UTSW 11 100355774 missense probably damaging 1.00
R6118:Hap1 UTSW 11 100355794 missense probably benign 0.24
R6148:Hap1 UTSW 11 100349392 missense probably damaging 1.00
R7221:Hap1 UTSW 11 100348829 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGCATCCTACAGCAAAGAGG -3'
(R):5'- GGTCCAGCAGATATCAGCTC -3'

Sequencing Primer
(F):5'- CTACAGCAAAGAGGGGAGACATTCC -3'
(R):5'- CCAGCAGATATCAGCTCGTTTGAG -3'
Posted On2019-11-12