Incidental Mutation 'R7683:Mier3'
ID592895
Institutional Source Beutler Lab
Gene Symbol Mier3
Ensembl Gene ENSMUSG00000032727
Gene NameMIER family member 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R7683 (G1)
Quality Score210.009
Status Not validated
Chromosome13
Chromosomal Location111680979-111718596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111705312 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000104895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047412] [ENSMUST00000109272] [ENSMUST00000137268] [ENSMUST00000231273] [ENSMUST00000231979]
Predicted Effect probably benign
Transcript: ENSMUST00000047412
AA Change: T109A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036809
Gene: ENSMUSG00000032727
AA Change: T109A

DomainStartEndE-ValueType
low complexity region 53 65 N/A INTRINSIC
ELM2 149 203 8.33e-14 SMART
SANT 251 300 5.32e-9 SMART
low complexity region 509 522 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000104894
Gene: ENSMUSG00000032727
AA Change: T134A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
ELM2 175 229 8.33e-14 SMART
SANT 277 326 5.32e-9 SMART
low complexity region 535 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109272
AA Change: T136A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104895
Gene: ENSMUSG00000032727
AA Change: T136A

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
ELM2 176 230 8.33e-14 SMART
SANT 279 328 5.32e-9 SMART
low complexity region 537 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137268
SMART Domains Protein: ENSMUSP00000117483
Gene: ENSMUSG00000032727

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 80 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231273
AA Change: T109A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231979
AA Change: T109A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Srsf7 A G 17: 80,207,274 probably benign Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Mier3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Mier3 APN 13 111714436 splice site probably benign
IGL03295:Mier3 APN 13 111703681 missense probably benign 0.00
IGL03054:Mier3 UTSW 13 111686314 start gained probably benign
R0119:Mier3 UTSW 13 111715038 missense probably damaging 1.00
R1106:Mier3 UTSW 13 111708229 missense probably damaging 1.00
R1453:Mier3 UTSW 13 111705244 missense probably damaging 1.00
R1463:Mier3 UTSW 13 111711755 missense probably damaging 0.99
R1555:Mier3 UTSW 13 111708359 missense probably damaging 0.98
R2413:Mier3 UTSW 13 111715128 utr 3 prime probably benign
R3055:Mier3 UTSW 13 111691303 missense probably damaging 1.00
R3114:Mier3 UTSW 13 111706648 missense probably damaging 0.98
R3115:Mier3 UTSW 13 111706648 missense probably damaging 0.98
R3116:Mier3 UTSW 13 111706648 missense probably damaging 0.98
R4345:Mier3 UTSW 13 111705283 missense probably damaging 1.00
R4834:Mier3 UTSW 13 111715109 nonsense probably null
R5050:Mier3 UTSW 13 111714573 missense possibly damaging 0.94
R5592:Mier3 UTSW 13 111706661 nonsense probably null
R5869:Mier3 UTSW 13 111714850 missense probably damaging 1.00
R6406:Mier3 UTSW 13 111709809 critical splice donor site probably null
R7151:Mier3 UTSW 13 111714768 missense probably benign 0.01
R7361:Mier3 UTSW 13 111705249 missense possibly damaging 0.91
R7362:Mier3 UTSW 13 111705249 missense possibly damaging 0.91
R7385:Mier3 UTSW 13 111705249 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTCAAACTTTTCAGAACCAGGGTG -3'
(R):5'- GATGAAAACAGGCAGCCTTG -3'

Sequencing Primer
(F):5'- ACCAGGGTGCAAATTGGTTC -3'
(R):5'- GCAAAACTACCTGAGTGTATGGGTTC -3'
Posted On2019-11-12