Incidental Mutation 'R7683:Srsf7'
ID592902
Institutional Source Beutler Lab
Gene Symbol Srsf7
Ensembl Gene ENSMUSG00000024097
Gene Nameserine/arginine-rich splicing factor 7
SynonymsSfrs7, 9430065L19Rik, 9G8, NX-96
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7683 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location80200089-80207305 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 80207274 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063417] [ENSMUST00000134652]
Predicted Effect probably benign
Transcript: ENSMUST00000063417
SMART Domains Protein: ENSMUSP00000070983
Gene: ENSMUSG00000024097

DomainStartEndE-ValueType
RRM 12 80 1.66e-20 SMART
ZnF_C2HC 105 121 1.77e-2 SMART
low complexity region 192 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134652
SMART Domains Protein: ENSMUSP00000123158
Gene: ENSMUSG00000046196

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 7.2e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Five transcript variants, four of them protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 A G 13: 59,512,498 C305R probably damaging Het
Anpep C A 7: 79,839,198 V381L probably damaging Het
Ap5s1 T C 2: 131,212,707 L146P probably damaging Het
Arhgef11 A G 3: 87,722,383 I599V probably damaging Het
Arpc2 T C 1: 74,263,814 Y250H probably damaging Het
Baz1b T A 5: 135,217,728 M677K probably damaging Het
Begain C T 12: 109,033,487 A453T unknown Het
C1ql4 T C 15: 99,087,211 D173G probably benign Het
Card11 T G 5: 140,896,026 N461T probably benign Het
Ccdc9 T C 7: 16,284,362 D7G probably damaging Het
Ces2a T C 8: 104,737,112 V152A probably benign Het
Chl1 G A 6: 103,691,652 A449T possibly damaging Het
Col11a1 G T 3: 114,113,736 G638W unknown Het
Cse1l A T 2: 166,922,788 T171S probably benign Het
D2hgdh T A 1: 93,838,965 probably null Het
Dlg4 T C 11: 70,039,854 Y432H possibly damaging Het
Dmwd C T 7: 19,080,735 L437F probably damaging Het
F11 T A 8: 45,249,508 Q251L probably damaging Het
Gm13078 A T 4: 143,726,714 K131* probably null Het
Gtf2f1 T A 17: 57,005,458 E195V possibly damaging Het
Hap1 A T 11: 100,351,548 L376Q probably damaging Het
Hars2 T A 18: 36,788,236 I234N probably damaging Het
Hcfc2 T C 10: 82,699,229 V29A probably benign Het
Hp C T 8: 109,579,099 probably benign Het
Hrh1 T C 6: 114,479,787 S10P probably benign Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm3a A G 6: 71,599,454 V792A probably benign Het
Kif13b G A 14: 64,757,507 V903I probably benign Het
Lars2 G T 9: 123,377,830 probably null Het
Med7 A G 11: 46,440,860 D94G possibly damaging Het
Mier3 A G 13: 111,705,312 T136A probably benign Het
Nin T C 12: 70,078,182 E122G Het
Olfr186 G T 16: 59,027,106 T267K probably benign Het
Olfr427 A G 1: 174,099,476 Q6R probably benign Het
Oxsr1 T C 9: 119,241,755 I489V probably benign Het
Pdcd6ip A T 9: 113,687,695 L216Q probably damaging Het
Ppp4r4 T A 12: 103,587,105 C379* probably null Het
Ptpn13 T A 5: 103,565,152 C1714S probably benign Het
Pum2 G A 12: 8,728,922 R498Q possibly damaging Het
Sema3d T A 5: 12,573,856 Y577* probably null Het
Slc29a3 G A 10: 60,716,366 P300S not run Het
Slc5a4b A G 10: 76,064,072 V444A probably damaging Het
Smad9 A G 3: 54,789,264 E250G probably damaging Het
Thsd7b A G 1: 129,595,946 Y239C probably damaging Het
Triml2 C A 8: 43,185,288 Q98K probably damaging Het
Txndc11 A T 16: 11,084,235 L705Q probably damaging Het
Vmn1r22 A G 6: 57,900,419 M191T probably damaging Het
Vmn2r89 A T 14: 51,455,194 K151N probably benign Het
Vwa5a A G 9: 38,734,829 I498V probably damaging Het
Zfp459 T C 13: 67,408,496 H156R probably damaging Het
Zscan18 T A 7: 12,769,605 K676* probably null Het
Other mutations in Srsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Srsf7 APN 17 80202692 missense probably null
IGL02544:Srsf7 APN 17 80204191 unclassified probably benign
R1036:Srsf7 UTSW 17 80205837 unclassified probably benign
R3014:Srsf7 UTSW 17 80201561 missense unknown
R6004:Srsf7 UTSW 17 80205853 missense probably damaging 1.00
R6298:Srsf7 UTSW 17 80207253 unclassified probably benign
R6551:Srsf7 UTSW 17 80204219 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATAACCGTCTCTAACCGCCG -3'
(R):5'- CATGGAAACGTATCCCTCCG -3'

Sequencing Primer
(F):5'- ATACCGCCCGTAGCGTGACA -3'
(R):5'- GAAACGTATCCCTCCGCTCCG -3'
Posted On2019-11-12