Incidental Mutation 'R7684:Slc39a12'
ID592908
Institutional Source Beutler Lab
Gene Symbol Slc39a12
Ensembl Gene ENSMUSG00000036949
Gene Namesolute carrier family 39 (zinc transporter), member 12
SynonymsLOC277468
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7684 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location14388316-14494977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14449859 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 563 (S563P)
Ref Sequence ENSEMBL: ENSMUSP00000080911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082290] [ENSMUST00000114731]
Predicted Effect probably damaging
Transcript: ENSMUST00000082290
AA Change: S563P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080911
Gene: ENSMUSG00000036949
AA Change: S563P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zip 364 681 1.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114731
AA Change: S527P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110379
Gene: ENSMUSG00000036949
AA Change: S527P

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Zip 382 511 2.5e-17 PFAM
Pfam:Zip 492 661 1.5e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc is an essential cofactor for hundreds of enzymes. It is involved in protein, nucleic acid, carbohydrate, and lipid metabolism, as well as in the control of gene transcription, growth, development, and differentiation. SLC39A12 belongs to a subfamily of proteins that show structural characteristics of zinc transporters (Taylor and Nicholson, 2003 [PubMed 12659941]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,540 K1239* probably null Het
Abhd6 T C 14: 8,039,807 F60S probably damaging Het
Adam6b G A 12: 113,491,576 W671* probably null Het
Ankrd36 A G 11: 5,570,113 T63A possibly damaging Het
Arhgef16 A G 4: 154,281,828 V494A possibly damaging Het
Arhgef7 T A 8: 11,819,663 M659K probably benign Het
Cacna1h A G 17: 25,389,372 Y854H probably damaging Het
Chd3 A T 11: 69,357,866 F780I possibly damaging Het
Cldn8 A G 16: 88,562,447 Y197H probably damaging Het
Cpne8 A T 15: 90,649,247 D58E probably damaging Het
Cul9 T G 17: 46,509,889 Y1954S probably damaging Het
Cyp4a10 T A 4: 115,518,352 F11I probably benign Het
Cysrt1 A T 2: 25,239,082 C139* probably null Het
Dnajc16 A G 4: 141,774,568 V317A probably benign Het
Dnmt3a T C 12: 3,897,340 V437A probably benign Het
Dok5 T C 2: 170,841,424 C202R probably damaging Het
Dusp11 T A 6: 85,950,560 R164S probably damaging Het
Dysf T C 6: 84,100,135 S648P probably benign Het
Egfem1 A T 3: 29,690,185 R581S probably damaging Het
Enpep A G 3: 129,321,445 F226S probably damaging Het
Ep400 A G 5: 110,697,352 I1541T unknown Het
Exd1 A G 2: 119,520,203 S526P probably damaging Het
Fam118a A G 15: 85,058,781 E337G possibly damaging Het
Fam20b T C 1: 156,690,645 N193S probably benign Het
Fat3 A G 9: 15,988,268 probably null Het
Flg2 T C 3: 93,219,649 V1956A unknown Het
Fzd10 A G 5: 128,601,416 I67V possibly damaging Het
Gckr A T 5: 31,307,797 D370V probably damaging Het
Gm8797 A T 3: 5,751,088 Q62L probably benign Het
H6pd G T 4: 149,996,062 Q109K probably benign Het
Higd1a T C 9: 121,850,256 K55R possibly damaging Het
Il1b C T 2: 129,367,357 V118I probably benign Het
Insr T C 8: 3,169,753 N923S possibly damaging Het
Krit1 A G 5: 3,830,723 I561V possibly damaging Het
Lamc2 T C 1: 153,127,025 D1070G probably null Het
Lpcat2 T A 8: 92,909,195 D408E possibly damaging Het
Mst1r T A 9: 107,911,563 F427Y probably benign Het
Mtx1 A T 3: 89,210,432 I258K possibly damaging Het
Nckap5 T C 1: 126,026,857 T653A probably benign Het
Npas3 A T 12: 54,068,826 N844Y probably damaging Het
Nrg3 A T 14: 39,472,565 L79Q probably damaging Het
Nsmce1 C A 7: 125,471,176 K154N probably damaging Het
Oard1 T C 17: 48,416,698 L124P probably damaging Het
Olfr1122 T C 2: 87,388,028 S108P probably damaging Het
Olfr1337 T C 4: 118,782,274 M104V probably benign Het
Olfr615 T C 7: 103,561,218 F247S probably benign Het
Olfr642 G A 7: 104,049,460 T298I probably damaging Het
Ovgp1 A T 3: 105,979,956 T223S probably damaging Het
Pik3c2a A T 7: 116,388,077 Y536* probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rxfp1 T A 3: 79,670,907 N159I possibly damaging Het
Sfmbt1 A G 14: 30,810,354 Q557R probably damaging Het
Slc22a18 G T 7: 143,490,840 V177L probably benign Het
Slc22a8 A G 19: 8,609,930 I451M probably benign Het
Snx20 T C 8: 88,627,235 D289G probably benign Het
Sptb A G 12: 76,612,195 Y1189H probably benign Het
Tbc1d1 T A 5: 64,316,486 M784K probably benign Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Thy1 G A 9: 44,046,558 G13D unknown Het
Ticam1 A G 17: 56,269,984 S704P unknown Het
Tmem151b A G 17: 45,547,003 Y106H probably damaging Het
Trappc8 T C 18: 20,863,502 N452S probably benign Het
Ttc9c A G 19: 8,811,764 Y166H probably damaging Het
Txndc16 A G 14: 45,147,868 V556A possibly damaging Het
Tyrp1 C A 4: 80,840,625 S245Y probably damaging Het
Urb1 A T 16: 90,786,118 L621* probably null Het
Wdr72 A T 9: 74,147,010 T224S probably damaging Het
Zc3h18 T G 8: 122,407,426 S544A unknown Het
Zfp462 T A 4: 55,008,908 N291K probably benign Het
Zfp609 T C 9: 65,731,080 N290S possibly damaging Het
Zfp979 A T 4: 147,613,342 H303Q probably damaging Het
Other mutations in Slc39a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Slc39a12 APN 2 14396068 splice site probably benign
IGL01597:Slc39a12 APN 2 14434309 missense possibly damaging 0.95
IGL02516:Slc39a12 APN 2 14400335 missense probably damaging 1.00
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0068:Slc39a12 UTSW 2 14435678 missense probably benign
R0453:Slc39a12 UTSW 2 14435681 missense probably benign 0.04
R0533:Slc39a12 UTSW 2 14400331 missense probably benign 0.00
R0718:Slc39a12 UTSW 2 14407426 splice site probably benign
R1647:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1648:Slc39a12 UTSW 2 14451992 missense probably benign 0.24
R1879:Slc39a12 UTSW 2 14444057 missense probably benign
R1993:Slc39a12 UTSW 2 14434219 missense probably damaging 0.98
R2429:Slc39a12 UTSW 2 14405086 missense probably benign 0.06
R3746:Slc39a12 UTSW 2 14396067 splice site probably benign
R3934:Slc39a12 UTSW 2 14434363 splice site probably benign
R3941:Slc39a12 UTSW 2 14396181 missense possibly damaging 0.95
R4008:Slc39a12 UTSW 2 14452117 missense probably damaging 1.00
R4478:Slc39a12 UTSW 2 14420179 nonsense probably null
R4622:Slc39a12 UTSW 2 14400325 missense probably benign 0.11
R4760:Slc39a12 UTSW 2 14400323 missense probably benign 0.14
R5477:Slc39a12 UTSW 2 14389382 missense possibly damaging 0.46
R5566:Slc39a12 UTSW 2 14407603 missense possibly damaging 0.80
R5725:Slc39a12 UTSW 2 14389264 start gained probably benign
R5798:Slc39a12 UTSW 2 14449826 missense probably damaging 1.00
R6074:Slc39a12 UTSW 2 14407479 nonsense probably null
R6169:Slc39a12 UTSW 2 14400233 missense possibly damaging 0.64
R6180:Slc39a12 UTSW 2 14396127 missense probably benign 0.38
R6802:Slc39a12 UTSW 2 14420085 missense probably benign 0.28
R6847:Slc39a12 UTSW 2 14449917 missense probably damaging 1.00
R6899:Slc39a12 UTSW 2 14389541 missense probably damaging 1.00
R6931:Slc39a12 UTSW 2 14389375 missense probably benign 0.04
R7131:Slc39a12 UTSW 2 14449803 missense probably damaging 1.00
R7343:Slc39a12 UTSW 2 14452000 missense probably damaging 1.00
R7525:Slc39a12 UTSW 2 14494461 missense probably benign 0.01
R7568:Slc39a12 UTSW 2 14400128 splice site probably null
R7761:Slc39a12 UTSW 2 14434330 missense probably benign 0.01
R7785:Slc39a12 UTSW 2 14420218 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTGCTAATGAGGTCTGAGG -3'
(R):5'- ATCAGCTTGAATCCCTGGGG -3'

Sequencing Primer
(F):5'- TGCTAATGAGGTCTGAGGTGAGAATG -3'
(R):5'- GCAAACTATTGGTGGGGAT -3'
Posted On2019-11-12