Incidental Mutation 'R7684:Il1b'
ID592912
Institutional Source Beutler Lab
Gene Symbol Il1b
Ensembl Gene ENSMUSG00000027398
Gene Nameinterleukin 1 beta
SynonymsIL-1B, IL-1beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7684 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129364570-129371139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129367357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 118 (V118I)
Ref Sequence ENSEMBL: ENSMUSP00000028881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028881]
PDB Structure
THE STRUCTURE OF MURINE INTERLEUKIN-1 BETA AT 2.8 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
A COMPARISON OF THE HIGH RESOLUTION STRUCTURES OF HUMAN AND MURINE INTERLEUKIN-1B [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028881
AA Change: V118I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028881
Gene: ENSMUSG00000027398
AA Change: V118I

DomainStartEndE-ValueType
Pfam:IL1_propep 1 102 3.3e-37 PFAM
IL1 120 265 1.74e-87 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1. The encoded protein plays a role in thymocyte proliferation and is involved in the inflammatory response. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mutants show impaired contact hypersensitivity and reduced acute-phase inflammatory response. Lung tumors and metastases of B16 melanoma do not occur in null mutant mice, suggesting inability to support tumor invasiveness and angiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,540 K1239* probably null Het
Abhd6 T C 14: 8,039,807 F60S probably damaging Het
Adam6b G A 12: 113,491,576 W671* probably null Het
Ankrd36 A G 11: 5,570,113 T63A possibly damaging Het
Arhgef16 A G 4: 154,281,828 V494A possibly damaging Het
Arhgef7 T A 8: 11,819,663 M659K probably benign Het
Cacna1h A G 17: 25,389,372 Y854H probably damaging Het
Chd3 A T 11: 69,357,866 F780I possibly damaging Het
Cldn8 A G 16: 88,562,447 Y197H probably damaging Het
Cpne8 A T 15: 90,649,247 D58E probably damaging Het
Cul9 T G 17: 46,509,889 Y1954S probably damaging Het
Cyp4a10 T A 4: 115,518,352 F11I probably benign Het
Cysrt1 A T 2: 25,239,082 C139* probably null Het
Dnajc16 A G 4: 141,774,568 V317A probably benign Het
Dnmt3a T C 12: 3,897,340 V437A probably benign Het
Dok5 T C 2: 170,841,424 C202R probably damaging Het
Dusp11 T A 6: 85,950,560 R164S probably damaging Het
Dysf T C 6: 84,100,135 S648P probably benign Het
Egfem1 A T 3: 29,690,185 R581S probably damaging Het
Enpep A G 3: 129,321,445 F226S probably damaging Het
Ep400 A G 5: 110,697,352 I1541T unknown Het
Exd1 A G 2: 119,520,203 S526P probably damaging Het
Fam118a A G 15: 85,058,781 E337G possibly damaging Het
Fam20b T C 1: 156,690,645 N193S probably benign Het
Fat3 A G 9: 15,988,268 probably null Het
Flg2 T C 3: 93,219,649 V1956A unknown Het
Fzd10 A G 5: 128,601,416 I67V possibly damaging Het
Gckr A T 5: 31,307,797 D370V probably damaging Het
Gm8797 A T 3: 5,751,088 Q62L probably benign Het
H6pd G T 4: 149,996,062 Q109K probably benign Het
Higd1a T C 9: 121,850,256 K55R possibly damaging Het
Insr T C 8: 3,169,753 N923S possibly damaging Het
Krit1 A G 5: 3,830,723 I561V possibly damaging Het
Lamc2 T C 1: 153,127,025 D1070G probably null Het
Lpcat2 T A 8: 92,909,195 D408E possibly damaging Het
Mst1r T A 9: 107,911,563 F427Y probably benign Het
Mtx1 A T 3: 89,210,432 I258K possibly damaging Het
Nckap5 T C 1: 126,026,857 T653A probably benign Het
Npas3 A T 12: 54,068,826 N844Y probably damaging Het
Nrg3 A T 14: 39,472,565 L79Q probably damaging Het
Nsmce1 C A 7: 125,471,176 K154N probably damaging Het
Oard1 T C 17: 48,416,698 L124P probably damaging Het
Olfr1122 T C 2: 87,388,028 S108P probably damaging Het
Olfr1337 T C 4: 118,782,274 M104V probably benign Het
Olfr615 T C 7: 103,561,218 F247S probably benign Het
Olfr642 G A 7: 104,049,460 T298I probably damaging Het
Ovgp1 A T 3: 105,979,956 T223S probably damaging Het
Pik3c2a A T 7: 116,388,077 Y536* probably null Het
Plekho2 A T 9: 65,559,534 probably null Het
Prelid3b T C 2: 174,468,417 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rxfp1 T A 3: 79,670,907 N159I possibly damaging Het
Sfmbt1 A G 14: 30,810,354 Q557R probably damaging Het
Slc22a18 G T 7: 143,490,840 V177L probably benign Het
Slc22a8 A G 19: 8,609,930 I451M probably benign Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Snx20 T C 8: 88,627,235 D289G probably benign Het
Sptb A G 12: 76,612,195 Y1189H probably benign Het
Tbc1d1 T A 5: 64,316,486 M784K probably benign Het
Tbkbp1 T C 11: 97,147,733 probably benign Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Thy1 G A 9: 44,046,558 G13D unknown Het
Ticam1 A G 17: 56,269,984 S704P unknown Het
Tmem151b A G 17: 45,547,003 Y106H probably damaging Het
Trappc8 T C 18: 20,863,502 N452S probably benign Het
Ttc9c A G 19: 8,811,764 Y166H probably damaging Het
Txndc16 A G 14: 45,147,868 V556A possibly damaging Het
Tyrp1 C A 4: 80,840,625 S245Y probably damaging Het
Urb1 A T 16: 90,786,118 L621* probably null Het
Wdr72 A T 9: 74,147,010 T224S probably damaging Het
Zc3h18 T G 8: 122,407,426 S544A unknown Het
Zfp462 T A 4: 55,008,908 N291K probably benign Het
Zfp609 T C 9: 65,731,080 N290S possibly damaging Het
Zfp979 A T 4: 147,613,342 H303Q probably damaging Het
Other mutations in Il1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Il1b APN 2 129367333 missense possibly damaging 0.82
IGL01488:Il1b APN 2 129367234 splice site probably benign
IGL01810:Il1b APN 2 129369729 missense probably damaging 1.00
IGL02041:Il1b APN 2 129369742 missense possibly damaging 0.95
IGL02726:Il1b APN 2 129367322 missense probably damaging 1.00
IGL02793:Il1b APN 2 129367251 missense probably benign 0.00
IGL02875:Il1b APN 2 129367251 missense probably benign 0.00
IGL02884:Il1b APN 2 129365102 missense probably benign 0.02
R1065:Il1b UTSW 2 129368007 missense probably benign 0.00
R1656:Il1b UTSW 2 129366069 missense probably damaging 0.99
R1761:Il1b UTSW 2 129365181 missense probably damaging 1.00
R2166:Il1b UTSW 2 129365048 missense probably damaging 0.97
R2568:Il1b UTSW 2 129367322 missense probably damaging 1.00
R4807:Il1b UTSW 2 129370306 missense probably benign 0.00
Z1177:Il1b UTSW 2 129369745 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTTAAAACACAGGGACCCAGTAGG -3'
(R):5'- AATGTTCTTGCCCAGCCCAC -3'

Sequencing Primer
(F):5'- ACCCAGTAGGCTGCCAG -3'
(R):5'- AGCCCACTCCCAGTGTTTTTATAC -3'
Posted On2019-11-12