Incidental Mutation 'R7684:Pik3c2a'
ID592938
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
SynonymsPI3KC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7684 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location116337265-116443449 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 116388077 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 536 (Y536*)
Ref Sequence ENSEMBL: ENSMUSP00000126092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000205378] [ENSMUST00000206219]
Predicted Effect probably null
Transcript: ENSMUST00000170430
AA Change: Y536*
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: Y536*

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205378
Predicted Effect probably null
Transcript: ENSMUST00000206219
AA Change: Y536*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,540 K1239* probably null Het
Abhd6 T C 14: 8,039,807 F60S probably damaging Het
Adam6b G A 12: 113,491,576 W671* probably null Het
Ankrd36 A G 11: 5,570,113 T63A possibly damaging Het
Arhgef16 A G 4: 154,281,828 V494A possibly damaging Het
Arhgef7 T A 8: 11,819,663 M659K probably benign Het
Cacna1h A G 17: 25,389,372 Y854H probably damaging Het
Chd3 A T 11: 69,357,866 F780I possibly damaging Het
Cldn8 A G 16: 88,562,447 Y197H probably damaging Het
Cpne8 A T 15: 90,649,247 D58E probably damaging Het
Cul9 T G 17: 46,509,889 Y1954S probably damaging Het
Cyp4a10 T A 4: 115,518,352 F11I probably benign Het
Cysrt1 A T 2: 25,239,082 C139* probably null Het
Dnajc16 A G 4: 141,774,568 V317A probably benign Het
Dnmt3a T C 12: 3,897,340 V437A probably benign Het
Dok5 T C 2: 170,841,424 C202R probably damaging Het
Dusp11 T A 6: 85,950,560 R164S probably damaging Het
Dysf T C 6: 84,100,135 S648P probably benign Het
Egfem1 A T 3: 29,690,185 R581S probably damaging Het
Enpep A G 3: 129,321,445 F226S probably damaging Het
Ep400 A G 5: 110,697,352 I1541T unknown Het
Exd1 A G 2: 119,520,203 S526P probably damaging Het
Fam118a A G 15: 85,058,781 E337G possibly damaging Het
Fam20b T C 1: 156,690,645 N193S probably benign Het
Fat3 A G 9: 15,988,268 probably null Het
Flg2 T C 3: 93,219,649 V1956A unknown Het
Fzd10 A G 5: 128,601,416 I67V possibly damaging Het
Gckr A T 5: 31,307,797 D370V probably damaging Het
Gm8797 A T 3: 5,751,088 Q62L probably benign Het
H6pd G T 4: 149,996,062 Q109K probably benign Het
Higd1a T C 9: 121,850,256 K55R possibly damaging Het
Il1b C T 2: 129,367,357 V118I probably benign Het
Insr T C 8: 3,169,753 N923S possibly damaging Het
Krit1 A G 5: 3,830,723 I561V possibly damaging Het
Lamc2 T C 1: 153,127,025 D1070G probably null Het
Lpcat2 T A 8: 92,909,195 D408E possibly damaging Het
Mst1r T A 9: 107,911,563 F427Y probably benign Het
Mtx1 A T 3: 89,210,432 I258K possibly damaging Het
Nckap5 T C 1: 126,026,857 T653A probably benign Het
Npas3 A T 12: 54,068,826 N844Y probably damaging Het
Nrg3 A T 14: 39,472,565 L79Q probably damaging Het
Nsmce1 C A 7: 125,471,176 K154N probably damaging Het
Oard1 T C 17: 48,416,698 L124P probably damaging Het
Olfr1122 T C 2: 87,388,028 S108P probably damaging Het
Olfr1337 T C 4: 118,782,274 M104V probably benign Het
Olfr615 T C 7: 103,561,218 F247S probably benign Het
Olfr642 G A 7: 104,049,460 T298I probably damaging Het
Ovgp1 A T 3: 105,979,956 T223S probably damaging Het
Plekho2 A T 9: 65,559,534 probably null Het
Prelid3b T C 2: 174,468,417 probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rxfp1 T A 3: 79,670,907 N159I possibly damaging Het
Sfmbt1 A G 14: 30,810,354 Q557R probably damaging Het
Slc22a18 G T 7: 143,490,840 V177L probably benign Het
Slc22a8 A G 19: 8,609,930 I451M probably benign Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Snx20 T C 8: 88,627,235 D289G probably benign Het
Sptb A G 12: 76,612,195 Y1189H probably benign Het
Tbc1d1 T A 5: 64,316,486 M784K probably benign Het
Tbkbp1 T C 11: 97,147,733 probably benign Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Thy1 G A 9: 44,046,558 G13D unknown Het
Ticam1 A G 17: 56,269,984 S704P unknown Het
Tmem151b A G 17: 45,547,003 Y106H probably damaging Het
Trappc8 T C 18: 20,863,502 N452S probably benign Het
Ttc9c A G 19: 8,811,764 Y166H probably damaging Het
Txndc16 A G 14: 45,147,868 V556A possibly damaging Het
Tyrp1 C A 4: 80,840,625 S245Y probably damaging Het
Urb1 A T 16: 90,786,118 L621* probably null Het
Wdr72 A T 9: 74,147,010 T224S probably damaging Het
Zc3h18 T G 8: 122,407,426 S544A unknown Het
Zfp462 T A 4: 55,008,908 N291K probably benign Het
Zfp609 T C 9: 65,731,080 N290S possibly damaging Het
Zfp979 A T 4: 147,613,342 H303Q probably damaging Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 116376283 missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 116364500 missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 116373803 missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116418194 missense probably benign 0.01
IGL01462:Pik3c2a APN 7 116376250 missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 116350765 intron probably benign
IGL01695:Pik3c2a APN 7 116417518 missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 116346188 missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 116350804 missense probably benign 0.00
IGL02160:Pik3c2a APN 7 116388064 missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 116363340 splice site probably benign
IGL02345:Pik3c2a APN 7 116405891 missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 116372814 missense probably benign 0.00
IGL02756:Pik3c2a APN 7 116364513 missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116418021 missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116417839 missense probably benign 0.21
R0046:Pik3c2a UTSW 7 116354072 missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 116373744 missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 116354055 missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 116346247 splice site probably benign
R0991:Pik3c2a UTSW 7 116362045 critical splice donor site probably null
R1074:Pik3c2a UTSW 7 116350925 nonsense probably null
R1485:Pik3c2a UTSW 7 116417673 missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 116388065 missense probably benign 0.01
R1510:Pik3c2a UTSW 7 116388045 missense probably benign 0.00
R1654:Pik3c2a UTSW 7 116368848 missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116417927 nonsense probably null
R1733:Pik3c2a UTSW 7 116418520 start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 116346236 missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116417664 missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 116376512 critical splice donor site probably null
R1826:Pik3c2a UTSW 7 116368117 missense probably benign
R1875:Pik3c2a UTSW 7 116417971 missense probably benign 0.35
R1995:Pik3c2a UTSW 7 116354006 missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 116342237 missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 116364503 missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 116350931 critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 116350822 missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116417451 critical splice donor site probably null
R2068:Pik3c2a UTSW 7 116372891 nonsense probably null
R3814:Pik3c2a UTSW 7 116348179 missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 116364550 nonsense probably null
R4386:Pik3c2a UTSW 7 116354099 missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 116358688 missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116417825 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 116340156 missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 116376283 missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 116348274 missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 116342401 missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 116350786 missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116417658 missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116405951 missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 116372814 missense probably benign 0.00
R5951:Pik3c2a UTSW 7 116368184 missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 116362564 missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 116348205 missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116417496 missense probably damaging 0.97
R6641:Pik3c2a UTSW 7 116340225 critical splice acceptor site probably null
R6661:Pik3c2a UTSW 7 116368758 missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 116362184 missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 116394305 missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116417988 missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116418133 nonsense probably null
R7153:Pik3c2a UTSW 7 116342252 missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 116388096 missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 116388086 missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116405943 missense probably benign 0.00
R7308:Pik3c2a UTSW 7 116373839 missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 116376386 missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 116354007 missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 116372854 missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 116394239 missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 116340096 missense probably damaging 0.97
R7737:Pik3c2a UTSW 7 116356253 missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 116394294 missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116417458 missense probably benign
R7935:Pik3c2a UTSW 7 116417458 missense probably benign
R8005:Pik3c2a UTSW 7 116418036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGCCAGTTCTACTTGGTA -3'
(R):5'- GCATTTTATCTCCAGCCCTCAAAA -3'

Sequencing Primer
(F):5'- CTAAGAGCTCTTCAACAGGGTGTC -3'
(R):5'- TTATCTCCAGCCCTCAAAAATTAGTC -3'
Posted On2019-11-12