Incidental Mutation 'R7684:Cul9'
ID592969
Institutional Source Beutler Lab
Gene Symbol Cul9
Ensembl Gene ENSMUSG00000040327
Gene Namecullin 9
Synonyms1810035I07Rik, Parc
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R7684 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46500572-46546388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 46509889 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 1954 (Y1954S)
Ref Sequence ENSEMBL: ENSMUSP00000138418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect probably damaging
Transcript: ENSMUST00000066026
AA Change: Y1954S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: Y1954S

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182485
AA Change: Y1954S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: Y1954S

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,612,540 K1239* probably null Het
Abhd6 T C 14: 8,039,807 F60S probably damaging Het
Adam6b G A 12: 113,491,576 W671* probably null Het
Ankrd36 A G 11: 5,570,113 T63A possibly damaging Het
Arhgef16 A G 4: 154,281,828 V494A possibly damaging Het
Arhgef7 T A 8: 11,819,663 M659K probably benign Het
Cacna1h A G 17: 25,389,372 Y854H probably damaging Het
Chd3 A T 11: 69,357,866 F780I possibly damaging Het
Cldn8 A G 16: 88,562,447 Y197H probably damaging Het
Cpne8 A T 15: 90,649,247 D58E probably damaging Het
Cyp4a10 T A 4: 115,518,352 F11I probably benign Het
Cysrt1 A T 2: 25,239,082 C139* probably null Het
Dnajc16 A G 4: 141,774,568 V317A probably benign Het
Dnmt3a T C 12: 3,897,340 V437A probably benign Het
Dok5 T C 2: 170,841,424 C202R probably damaging Het
Dusp11 T A 6: 85,950,560 R164S probably damaging Het
Dysf T C 6: 84,100,135 S648P probably benign Het
Egfem1 A T 3: 29,690,185 R581S probably damaging Het
Enpep A G 3: 129,321,445 F226S probably damaging Het
Ep400 A G 5: 110,697,352 I1541T unknown Het
Exd1 A G 2: 119,520,203 S526P probably damaging Het
Fam118a A G 15: 85,058,781 E337G possibly damaging Het
Fam20b T C 1: 156,690,645 N193S probably benign Het
Fat3 A G 9: 15,988,268 probably null Het
Flg2 T C 3: 93,219,649 V1956A unknown Het
Fzd10 A G 5: 128,601,416 I67V possibly damaging Het
Gckr A T 5: 31,307,797 D370V probably damaging Het
Gm8797 A T 3: 5,751,088 Q62L probably benign Het
H6pd G T 4: 149,996,062 Q109K probably benign Het
Higd1a T C 9: 121,850,256 K55R possibly damaging Het
Il1b C T 2: 129,367,357 V118I probably benign Het
Insr T C 8: 3,169,753 N923S possibly damaging Het
Krit1 A G 5: 3,830,723 I561V possibly damaging Het
Lamc2 T C 1: 153,127,025 D1070G probably null Het
Lpcat2 T A 8: 92,909,195 D408E possibly damaging Het
Mst1r T A 9: 107,911,563 F427Y probably benign Het
Mtx1 A T 3: 89,210,432 I258K possibly damaging Het
Nckap5 T C 1: 126,026,857 T653A probably benign Het
Npas3 A T 12: 54,068,826 N844Y probably damaging Het
Nrg3 A T 14: 39,472,565 L79Q probably damaging Het
Nsmce1 C A 7: 125,471,176 K154N probably damaging Het
Oard1 T C 17: 48,416,698 L124P probably damaging Het
Olfr1122 T C 2: 87,388,028 S108P probably damaging Het
Olfr1337 T C 4: 118,782,274 M104V probably benign Het
Olfr615 T C 7: 103,561,218 F247S probably benign Het
Olfr642 G A 7: 104,049,460 T298I probably damaging Het
Ovgp1 A T 3: 105,979,956 T223S probably damaging Het
Pik3c2a A T 7: 116,388,077 Y536* probably null Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rxfp1 T A 3: 79,670,907 N159I possibly damaging Het
Sfmbt1 A G 14: 30,810,354 Q557R probably damaging Het
Slc22a18 G T 7: 143,490,840 V177L probably benign Het
Slc22a8 A G 19: 8,609,930 I451M probably benign Het
Slc39a12 T C 2: 14,449,859 S563P probably damaging Het
Snx20 T C 8: 88,627,235 D289G probably benign Het
Sptb A G 12: 76,612,195 Y1189H probably benign Het
Tbc1d1 T A 5: 64,316,486 M784K probably benign Het
Tfap2b G C 1: 19,214,287 D140H probably damaging Het
Thy1 G A 9: 44,046,558 G13D unknown Het
Ticam1 A G 17: 56,269,984 S704P unknown Het
Tmem151b A G 17: 45,547,003 Y106H probably damaging Het
Trappc8 T C 18: 20,863,502 N452S probably benign Het
Ttc9c A G 19: 8,811,764 Y166H probably damaging Het
Txndc16 A G 14: 45,147,868 V556A possibly damaging Het
Tyrp1 C A 4: 80,840,625 S245Y probably damaging Het
Urb1 A T 16: 90,786,118 L621* probably null Het
Wdr72 A T 9: 74,147,010 T224S probably damaging Het
Zc3h18 T G 8: 122,407,426 S544A unknown Het
Zfp462 T A 4: 55,008,908 N291K probably benign Het
Zfp609 T C 9: 65,731,080 N290S possibly damaging Het
Zfp979 A T 4: 147,613,342 H303Q probably damaging Het
Other mutations in Cul9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cul9 APN 17 46525709 missense probably damaging 1.00
IGL00330:Cul9 APN 17 46510841 splice site probably benign
IGL00726:Cul9 APN 17 46528096 missense probably damaging 1.00
IGL01020:Cul9 APN 17 46539023 missense probably damaging 1.00
IGL01358:Cul9 APN 17 46538314 missense probably damaging 1.00
IGL01410:Cul9 APN 17 46528646 missense probably damaging 0.99
IGL01781:Cul9 APN 17 46539304 missense probably benign
IGL01873:Cul9 APN 17 46502452 missense probably damaging 0.99
IGL02117:Cul9 APN 17 46540375 missense probably benign 0.00
IGL02300:Cul9 APN 17 46521032 splice site probably benign
IGL02426:Cul9 APN 17 46523258 missense possibly damaging 0.95
IGL02427:Cul9 APN 17 46502632 missense possibly damaging 0.69
IGL02496:Cul9 APN 17 46540376 missense possibly damaging 0.72
IGL03008:Cul9 APN 17 46502697 splice site probably benign
IGL03059:Cul9 APN 17 46538987 missense probably damaging 0.98
IGL03302:Cul9 APN 17 46526640 missense probably damaging 0.98
bottlenose UTSW 17 46500844 missense possibly damaging 0.79
flipper UTSW 17 46525892 missense probably benign 0.05
orca UTSW 17 46525135 missense probably damaging 1.00
FR4340:Cul9 UTSW 17 46500853 small insertion probably benign
FR4449:Cul9 UTSW 17 46500856 small insertion probably benign
FR4737:Cul9 UTSW 17 46500846 small insertion probably benign
FR4737:Cul9 UTSW 17 46500858 small insertion probably benign
FR4976:Cul9 UTSW 17 46500848 small insertion probably benign
FR4976:Cul9 UTSW 17 46500850 small insertion probably benign
FR4976:Cul9 UTSW 17 46500853 small insertion probably benign
FR4976:Cul9 UTSW 17 46500856 small insertion probably benign
R0012:Cul9 UTSW 17 46538510 missense probably benign 0.26
R0079:Cul9 UTSW 17 46537663 nonsense probably null
R0143:Cul9 UTSW 17 46526410 missense possibly damaging 0.65
R0390:Cul9 UTSW 17 46528589 missense probably benign 0.34
R0401:Cul9 UTSW 17 46541704 missense probably damaging 1.00
R0529:Cul9 UTSW 17 46520468 splice site probably benign
R0815:Cul9 UTSW 17 46537822 splice site probably null
R0863:Cul9 UTSW 17 46537822 splice site probably null
R0972:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1173:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1216:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1217:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1261:Cul9 UTSW 17 46525782 missense probably damaging 1.00
R1278:Cul9 UTSW 17 46500849 small deletion probably benign
R1281:Cul9 UTSW 17 46511534 missense probably damaging 1.00
R1349:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1372:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1482:Cul9 UTSW 17 46508547 missense probably damaging 0.99
R1491:Cul9 UTSW 17 46538564 nonsense probably null
R1618:Cul9 UTSW 17 46525892 missense probably benign 0.05
R1641:Cul9 UTSW 17 46543560 missense possibly damaging 0.96
R1679:Cul9 UTSW 17 46521156 missense possibly damaging 0.90
R1771:Cul9 UTSW 17 46537812 missense probably benign 0.41
R1803:Cul9 UTSW 17 46503097 missense probably damaging 1.00
R2020:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R2046:Cul9 UTSW 17 46543733 missense probably damaging 1.00
R2056:Cul9 UTSW 17 46543372 missense probably benign
R2088:Cul9 UTSW 17 46526649 missense probably damaging 1.00
R2415:Cul9 UTSW 17 46543438 missense probably benign
R2925:Cul9 UTSW 17 46510981 missense probably benign 0.08
R2964:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R2965:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R3690:Cul9 UTSW 17 46504031 splice site probably null
R3847:Cul9 UTSW 17 46525135 missense probably damaging 1.00
R4437:Cul9 UTSW 17 46502159 missense probably damaging 1.00
R4470:Cul9 UTSW 17 46538336 missense probably benign 0.00
R4540:Cul9 UTSW 17 46503089 missense probably null 0.98
R4555:Cul9 UTSW 17 46501829 missense possibly damaging 0.82
R4604:Cul9 UTSW 17 46530146 missense probably damaging 0.99
R4646:Cul9 UTSW 17 46539017 nonsense probably null
R4799:Cul9 UTSW 17 46500844 missense possibly damaging 0.79
R4822:Cul9 UTSW 17 46530051 missense probably benign 0.01
R4964:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R4965:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R5027:Cul9 UTSW 17 46500782 missense probably damaging 0.99
R5185:Cul9 UTSW 17 46525832 missense possibly damaging 0.95
R5237:Cul9 UTSW 17 46543467 missense probably benign 0.00
R5278:Cul9 UTSW 17 46510873 missense probably damaging 1.00
R5361:Cul9 UTSW 17 46500849 small deletion probably benign
R5455:Cul9 UTSW 17 46510846 splice site probably null
R5592:Cul9 UTSW 17 46520591 missense probably benign 0.00
R5597:Cul9 UTSW 17 46502665 missense possibly damaging 0.56
R5613:Cul9 UTSW 17 46503844 missense probably damaging 1.00
R6122:Cul9 UTSW 17 46521928 missense possibly damaging 0.72
R6135:Cul9 UTSW 17 46521453 missense probably benign
R6352:Cul9 UTSW 17 46511315 missense probably benign 0.00
R6376:Cul9 UTSW 17 46508563 missense probably damaging 1.00
R6868:Cul9 UTSW 17 46522183 missense possibly damaging 0.73
R6898:Cul9 UTSW 17 46511026 missense possibly damaging 0.87
R7090:Cul9 UTSW 17 46500839 missense probably damaging 0.96
R7193:Cul9 UTSW 17 46538497 missense probably damaging 0.98
R7221:Cul9 UTSW 17 46528565 missense probably damaging 0.99
R7291:Cul9 UTSW 17 46540433 missense probably benign 0.00
R7320:Cul9 UTSW 17 46510909 missense possibly damaging 0.80
R7348:Cul9 UTSW 17 46510993 missense possibly damaging 0.89
R7463:Cul9 UTSW 17 46520476 splice site probably null
R7480:Cul9 UTSW 17 46537812 missense probably benign 0.41
R7573:Cul9 UTSW 17 46519910 missense probably benign
R7582:Cul9 UTSW 17 46510979 missense probably damaging 1.00
R7605:Cul9 UTSW 17 46541732 missense probably damaging 0.99
R7830:Cul9 UTSW 17 46540311 missense probably benign 0.37
R7917:Cul9 UTSW 17 46525704 splice site probably null
RF011:Cul9 UTSW 17 46500848 small insertion probably benign
RF016:Cul9 UTSW 17 46500863 nonsense probably null
RF026:Cul9 UTSW 17 46500869 nonsense probably null
RF027:Cul9 UTSW 17 46500848 small insertion probably benign
RF030:Cul9 UTSW 17 46500869 small insertion probably benign
RF033:Cul9 UTSW 17 46500854 small insertion probably benign
RF039:Cul9 UTSW 17 46500854 small insertion probably benign
RF041:Cul9 UTSW 17 46500854 nonsense probably null
RF042:Cul9 UTSW 17 46540615 frame shift probably null
RF057:Cul9 UTSW 17 46500863 nonsense probably null
Z1176:Cul9 UTSW 17 46520576 nonsense probably null
Z1176:Cul9 UTSW 17 46520585 nonsense probably null
Z1177:Cul9 UTSW 17 46537797 missense not run
Predicted Primers PCR Primer
(F):5'- GATCTGATGGTATGTGTCAAGACAT -3'
(R):5'- GTGCTTACCACGTGTCTGAGT -3'

Sequencing Primer
(F):5'- GAGCTTTGGCCCTGTAAT -3'
(R):5'- GGTAACATACCTGGTCTCATGGC -3'
Posted On2019-11-12