Incidental Mutation 'R7685:Scn7a'
ID 592981
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms 1110034K09Rik, NaG, Nav2, Nax, Nav2.3, Scn6a
MMRRC Submission 045750-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R7685 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66503770-66615254 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66506536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 1451 (C1451Y)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: C1451Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: C1451Y

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 105,116,081 (GRCm39) L251S probably damaging Het
Acsbg1 C T 9: 54,535,843 (GRCm39) S53N unknown Het
Adamts18 A G 8: 114,439,855 (GRCm39) C913R probably damaging Het
Adck5 C A 15: 76,479,588 (GRCm39) Y524* probably null Het
Adgrv1 G T 13: 81,251,443 (GRCm39) Q6225K possibly damaging Het
Ahr T C 12: 35,554,016 (GRCm39) N701S probably damaging Het
Apc T C 18: 34,447,261 (GRCm39) C1386R probably damaging Het
Bbs1 A G 19: 4,956,182 (GRCm39) S38P probably benign Het
Celsr1 G T 15: 85,862,933 (GRCm39) C1366* probably null Het
Cep290 A C 10: 100,375,919 (GRCm39) H1424P probably benign Het
Clcn3 C T 8: 61,386,119 (GRCm39) R311K possibly damaging Het
Crat C T 2: 30,294,577 (GRCm39) R497Q probably benign Het
Dhx9 A G 1: 153,334,152 (GRCm39) Y1002H probably damaging Het
Dnah8 C T 17: 30,876,947 (GRCm39) T533I probably damaging Het
Ermard T C 17: 15,279,724 (GRCm39) S505P probably benign Het
Fbxw17 G A 13: 50,579,680 (GRCm39) D166N probably damaging Het
Fmo3 T C 1: 162,785,901 (GRCm39) K363R possibly damaging Het
Frey1 C A 2: 92,213,817 (GRCm39) P68Q probably damaging Het
Gadd45gip1 A T 8: 85,558,980 (GRCm39) R21W probably damaging Het
Galnt4 A G 10: 98,945,826 (GRCm39) N517S probably benign Het
Ganc T A 2: 120,264,273 (GRCm39) W409R probably damaging Het
Glrx3 T C 7: 137,060,920 (GRCm39) S185P probably damaging Het
Gm49368 T C 7: 127,712,414 (GRCm39) S853P probably damaging Het
Gtf3c2 A C 5: 31,325,611 (GRCm39) L443V probably damaging Het
Gxylt2 A T 6: 100,781,489 (GRCm39) Q388L probably benign Het
Hcar2 C T 5: 124,003,396 (GRCm39) V36M possibly damaging Het
Ifit3b A T 19: 34,589,955 (GRCm39) D377V possibly damaging Het
Ints5 A G 19: 8,874,168 (GRCm39) D709G probably benign Het
Lyst A G 13: 13,844,450 (GRCm39) E1880G probably benign Het
Mep1a C T 17: 43,790,065 (GRCm39) S428N probably benign Het
Mllt6 T C 11: 97,567,790 (GRCm39) L739P probably damaging Het
Mlst8 T C 17: 24,695,031 (GRCm39) Y284C probably damaging Het
Mmel1 T C 4: 154,956,111 (GRCm39) M1T probably null Het
Muc5ac C T 7: 141,363,120 (GRCm39) P2144S unknown Het
Myh4 T C 11: 67,131,756 (GRCm39) V72A probably benign Het
Naa15 T A 3: 51,377,395 (GRCm39) probably null Het
Nlrc5 A G 8: 95,248,028 (GRCm39) probably null Het
Nme8 T A 13: 19,835,145 (GRCm39) M514L probably benign Het
Nudt9 C A 5: 104,194,946 (GRCm39) S14* probably null Het
Optn G A 2: 5,059,461 (GRCm39) T19I probably benign Het
Or11h23 A T 14: 50,948,215 (GRCm39) I143F possibly damaging Het
Or13a24 T C 7: 140,154,159 (GRCm39) F31S probably damaging Het
Osbpl8 T A 10: 111,112,370 (GRCm39) L495* probably null Het
Panx2 T C 15: 88,951,973 (GRCm39) S147P possibly damaging Het
Pclo T A 5: 14,730,630 (GRCm39) V3044D unknown Het
Pcnt T C 10: 76,258,642 (GRCm39) K608E probably benign Het
Pde7a T A 3: 19,281,909 (GRCm39) N447I probably damaging Het
Peli2 G T 14: 48,517,491 (GRCm39) C186F not run Het
Pgm5 A G 19: 24,705,215 (GRCm39) F433L probably benign Het
Plce1 G A 19: 38,736,877 (GRCm39) V1588I probably benign Het
Plin4 T A 17: 56,409,413 (GRCm39) H1295L probably benign Het
Poli T C 18: 70,658,590 (GRCm39) E134G probably benign Het
Pramel11 T A 4: 143,624,371 (GRCm39) D42V probably benign Het
Ptprq T A 10: 107,479,839 (GRCm39) I1144F probably damaging Het
Ptprz1 A T 6: 23,024,977 (GRCm39) T1738S probably damaging Het
Pxdc1 A G 13: 34,836,267 (GRCm39) L51P probably damaging Het
Rabepk C T 2: 34,669,308 (GRCm39) G362S probably damaging Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rhd T A 4: 134,611,820 (GRCm39) probably null Het
Rpp14 T C 14: 8,090,453 (GRCm38) S126P probably damaging Het
Sdr39u1 G A 14: 56,135,191 (GRCm39) R251* probably null Het
Sephs2 G T 7: 126,872,506 (GRCm39) P196T possibly damaging Het
Slc22a16 T C 10: 40,450,085 (GRCm39) Y195H possibly damaging Het
Spg11 C A 2: 121,899,361 (GRCm39) V1575F probably damaging Het
Sqle C T 15: 59,187,890 (GRCm39) S66L probably benign Het
Tas2r124 T G 6: 132,732,056 (GRCm39) W122G probably damaging Het
Tex52 A T 6: 128,361,921 (GRCm39) probably null Het
Thoc1 T A 18: 9,993,454 (GRCm39) C604* probably null Het
Tmc3 T C 7: 83,246,666 (GRCm39) S136P probably damaging Het
Tmem212 T A 3: 27,950,462 (GRCm39) T11S probably benign Het
Ubn2 A G 6: 38,468,727 (GRCm39) N1147S probably benign Het
Uggt2 A G 14: 119,312,759 (GRCm39) I350T probably damaging Het
Ust A T 10: 8,083,339 (GRCm39) Y346N probably damaging Het
Vwa8 A G 14: 79,335,740 (GRCm39) T1399A probably benign Het
Zc3h18 G A 8: 123,140,615 (GRCm39) R850Q unknown Het
Zfp800 C A 6: 28,244,193 (GRCm39) K257N probably damaging Het
Zfp985 T A 4: 147,667,331 (GRCm39) D66E probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66,513,671 (GRCm39) splice site probably benign
IGL00432:Scn7a APN 2 66,572,326 (GRCm39) nonsense probably null
IGL00720:Scn7a APN 2 66,506,388 (GRCm39) missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00784:Scn7a APN 2 66,522,908 (GRCm39) missense probably damaging 0.99
IGL00926:Scn7a APN 2 66,514,475 (GRCm39) missense probably benign 0.06
IGL00963:Scn7a APN 2 66,534,289 (GRCm39) splice site probably benign
IGL01099:Scn7a APN 2 66,514,582 (GRCm39) missense probably damaging 1.00
IGL01326:Scn7a APN 2 66,582,604 (GRCm39) missense probably benign 0.13
IGL01538:Scn7a APN 2 66,534,196 (GRCm39) missense probably benign
IGL01624:Scn7a APN 2 66,582,269 (GRCm39) missense probably benign 0.07
IGL01794:Scn7a APN 2 66,505,853 (GRCm39) missense probably benign
IGL02100:Scn7a APN 2 66,505,843 (GRCm39) makesense probably null
IGL02326:Scn7a APN 2 66,530,392 (GRCm39) missense probably benign 0.00
IGL02472:Scn7a APN 2 66,582,658 (GRCm39) missense probably damaging 1.00
IGL02528:Scn7a APN 2 66,530,519 (GRCm39) missense probably damaging 1.00
IGL02798:Scn7a APN 2 66,544,219 (GRCm39) missense probably benign 0.00
IGL03026:Scn7a APN 2 66,506,442 (GRCm39) missense probably damaging 0.99
IGL03071:Scn7a APN 2 66,530,291 (GRCm39) missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66,528,160 (GRCm39) missense probably benign 0.01
IGL03180:Scn7a APN 2 66,506,578 (GRCm39) missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66,506,304 (GRCm39) missense probably benign 0.00
alert UTSW 2 66,510,590 (GRCm39) nonsense probably null
glimmer UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
Uptick UTSW 2 66,530,393 (GRCm39) nonsense probably null
PIT4514001:Scn7a UTSW 2 66,514,523 (GRCm39) missense probably damaging 1.00
R0004:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66,544,381 (GRCm39) missense probably benign 0.04
R0230:Scn7a UTSW 2 66,556,628 (GRCm39) missense probably damaging 1.00
R0463:Scn7a UTSW 2 66,506,084 (GRCm39) missense probably benign 0.05
R0846:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66,510,639 (GRCm39) missense probably damaging 0.98
R1282:Scn7a UTSW 2 66,531,193 (GRCm39) missense probably damaging 0.98
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1467:Scn7a UTSW 2 66,519,902 (GRCm39) missense probably benign 0.01
R1501:Scn7a UTSW 2 66,530,507 (GRCm39) missense probably benign 0.37
R1672:Scn7a UTSW 2 66,527,944 (GRCm39) missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66,506,287 (GRCm39) missense probably damaging 0.99
R1712:Scn7a UTSW 2 66,535,447 (GRCm39) missense probably benign 0.05
R1758:Scn7a UTSW 2 66,531,231 (GRCm39) missense probably damaging 0.97
R1758:Scn7a UTSW 2 66,510,527 (GRCm39) missense probably benign 0.00
R1775:Scn7a UTSW 2 66,511,299 (GRCm39) missense probably benign 0.02
R1848:Scn7a UTSW 2 66,514,357 (GRCm39) critical splice donor site probably null
R1851:Scn7a UTSW 2 66,510,635 (GRCm39) missense probably benign
R1919:Scn7a UTSW 2 66,530,317 (GRCm39) missense probably damaging 1.00
R1932:Scn7a UTSW 2 66,506,446 (GRCm39) missense probably damaging 1.00
R1945:Scn7a UTSW 2 66,506,324 (GRCm39) missense probably damaging 1.00
R1970:Scn7a UTSW 2 66,514,633 (GRCm39) missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66,513,613 (GRCm39) missense probably damaging 0.99
R2008:Scn7a UTSW 2 66,518,091 (GRCm39) missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66,567,780 (GRCm39) missense probably damaging 1.00
R2113:Scn7a UTSW 2 66,506,312 (GRCm39) missense probably damaging 1.00
R2128:Scn7a UTSW 2 66,528,330 (GRCm39) missense probably damaging 0.99
R2163:Scn7a UTSW 2 66,506,300 (GRCm39) missense probably damaging 0.97
R2421:Scn7a UTSW 2 66,556,646 (GRCm39) splice site probably benign
R2446:Scn7a UTSW 2 66,523,002 (GRCm39) missense probably damaging 0.98
R2922:Scn7a UTSW 2 66,530,551 (GRCm39) splice site probably benign
R3015:Scn7a UTSW 2 66,530,240 (GRCm39) missense probably benign 0.08
R3034:Scn7a UTSW 2 66,513,152 (GRCm39) missense probably damaging 1.00
R3419:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3429:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3430:Scn7a UTSW 2 66,531,239 (GRCm39) frame shift probably null
R3434:Scn7a UTSW 2 66,505,847 (GRCm39) missense probably benign 0.01
R3803:Scn7a UTSW 2 66,510,590 (GRCm39) nonsense probably null
R3831:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R3833:Scn7a UTSW 2 66,528,028 (GRCm39) missense probably damaging 0.96
R4017:Scn7a UTSW 2 66,572,329 (GRCm39) missense probably damaging 1.00
R4244:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4245:Scn7a UTSW 2 66,572,345 (GRCm39) missense probably benign 0.00
R4276:Scn7a UTSW 2 66,514,407 (GRCm39) missense probably damaging 0.97
R4307:Scn7a UTSW 2 66,506,099 (GRCm39) missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66,567,815 (GRCm39) missense probably damaging 1.00
R4353:Scn7a UTSW 2 66,506,780 (GRCm39) missense probably benign 0.00
R4721:Scn7a UTSW 2 66,514,529 (GRCm39) missense probably damaging 1.00
R4722:Scn7a UTSW 2 66,531,228 (GRCm39) missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66,534,104 (GRCm39) missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66,556,592 (GRCm39) missense probably damaging 1.00
R5362:Scn7a UTSW 2 66,530,342 (GRCm39) missense probably damaging 1.00
R5437:Scn7a UTSW 2 66,506,690 (GRCm39) missense probably damaging 1.00
R5729:Scn7a UTSW 2 66,572,301 (GRCm39) critical splice donor site probably null
R5777:Scn7a UTSW 2 66,522,913 (GRCm39) missense probably damaging 1.00
R5785:Scn7a UTSW 2 66,527,912 (GRCm39) missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66,574,047 (GRCm39) missense probably damaging 0.96
R5830:Scn7a UTSW 2 66,544,395 (GRCm39) nonsense probably null
R5877:Scn7a UTSW 2 66,530,217 (GRCm39) nonsense probably null
R5881:Scn7a UTSW 2 66,505,870 (GRCm39) missense probably benign 0.01
R5967:Scn7a UTSW 2 66,506,057 (GRCm39) missense probably damaging 1.00
R5988:Scn7a UTSW 2 66,556,558 (GRCm39) nonsense probably null
R6077:Scn7a UTSW 2 66,527,940 (GRCm39) missense probably damaging 1.00
R6135:Scn7a UTSW 2 66,534,244 (GRCm39) missense probably benign
R6242:Scn7a UTSW 2 66,531,110 (GRCm39) missense probably benign 0.00
R6264:Scn7a UTSW 2 66,505,870 (GRCm39) missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66,530,458 (GRCm39) missense probably damaging 0.98
R6544:Scn7a UTSW 2 66,514,444 (GRCm39) missense probably damaging 1.00
R6770:Scn7a UTSW 2 66,559,528 (GRCm39) splice site probably null
R6997:Scn7a UTSW 2 66,534,147 (GRCm39) missense probably damaging 1.00
R7014:Scn7a UTSW 2 66,572,303 (GRCm39) missense probably null 1.00
R7126:Scn7a UTSW 2 66,587,630 (GRCm39) missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66,530,537 (GRCm39) missense probably benign 0.14
R7176:Scn7a UTSW 2 66,506,632 (GRCm39) missense probably damaging 1.00
R7185:Scn7a UTSW 2 66,518,139 (GRCm39) missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66,587,506 (GRCm39) missense probably damaging 1.00
R7332:Scn7a UTSW 2 66,522,898 (GRCm39) nonsense probably null
R7421:Scn7a UTSW 2 66,505,876 (GRCm39) missense probably benign 0.07
R7488:Scn7a UTSW 2 66,587,574 (GRCm39) missense probably benign 0.16
R7636:Scn7a UTSW 2 66,574,172 (GRCm39) missense possibly damaging 0.67
R7711:Scn7a UTSW 2 66,531,221 (GRCm39) missense probably damaging 1.00
R7813:Scn7a UTSW 2 66,506,689 (GRCm39) missense probably damaging 1.00
R7833:Scn7a UTSW 2 66,506,494 (GRCm39) missense probably damaging 1.00
R7914:Scn7a UTSW 2 66,530,294 (GRCm39) missense probably damaging 0.97
R7953:Scn7a UTSW 2 66,587,670 (GRCm39) missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66,506,173 (GRCm39) missense probably damaging 1.00
R8061:Scn7a UTSW 2 66,522,938 (GRCm39) missense probably damaging 1.00
R8121:Scn7a UTSW 2 66,531,203 (GRCm39) missense probably damaging 1.00
R8172:Scn7a UTSW 2 66,506,191 (GRCm39) missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66,531,204 (GRCm39) missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66,506,318 (GRCm39) missense probably damaging 1.00
R8431:Scn7a UTSW 2 66,534,164 (GRCm39) missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66,574,041 (GRCm39) splice site probably benign
R8745:Scn7a UTSW 2 66,510,526 (GRCm39) missense probably benign
R8781:Scn7a UTSW 2 66,567,775 (GRCm39) missense probably benign 0.03
R8848:Scn7a UTSW 2 66,530,393 (GRCm39) nonsense probably null
R8878:Scn7a UTSW 2 66,506,199 (GRCm39) missense probably damaging 1.00
R8943:Scn7a UTSW 2 66,525,206 (GRCm39) synonymous silent
R8991:Scn7a UTSW 2 66,514,588 (GRCm39) missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66,514,507 (GRCm39) missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66,510,456 (GRCm39) missense probably damaging 1.00
R9501:Scn7a UTSW 2 66,582,579 (GRCm39) missense probably benign 0.00
R9546:Scn7a UTSW 2 66,582,603 (GRCm39) missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66,519,902 (GRCm39) missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66,520,026 (GRCm39) missense probably benign 0.01
X0066:Scn7a UTSW 2 66,510,536 (GRCm39) missense probably benign
Z1088:Scn7a UTSW 2 66,544,295 (GRCm39) missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66,582,613 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAAACCTGTTCCACAC -3'
(R):5'- CGCCATCTTTGGAATGTACAAC -3'

Sequencing Primer
(F):5'- AAAGTCATCTTCACTCAAGGTCCTG -3'
(R):5'- CTTTGCCTATGTAAAGAAAGAAGCCG -3'
Posted On 2019-11-12