Incidental Mutation 'R7685:Scn7a'
ID 592981
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Name sodium channel, voltage-gated, type VII, alpha
Synonyms NaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R7685 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 66673425-66784914 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66676192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 1451 (C1451Y)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
AlphaFold B1AYL1
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: C1451Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: C1451Y

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik C A 2: 92,383,472 P68Q probably damaging Het
Abcg3 A G 5: 104,968,215 L251S probably damaging Het
Acsbg1 C T 9: 54,628,559 S53N unknown Het
Adamts18 A G 8: 113,713,223 C913R probably damaging Het
Adck5 C A 15: 76,595,388 Y524* probably null Het
Adgrv1 G T 13: 81,103,324 Q6225K possibly damaging Het
Ahr T C 12: 35,504,017 N701S probably damaging Het
Apc T C 18: 34,314,208 C1386R probably damaging Het
Bbs1 A G 19: 4,906,154 S38P probably benign Het
Celsr1 G T 15: 85,978,732 C1366* probably null Het
Cep290 A C 10: 100,540,057 H1424P probably benign Het
Clcn3 C T 8: 60,933,085 R311K possibly damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dhx9 A G 1: 153,458,406 Y1002H probably damaging Het
Dnah8 C T 17: 30,657,973 T533I probably damaging Het
Ermard T C 17: 15,059,462 S505P probably benign Het
Fbxw17 G A 13: 50,425,644 D166N probably damaging Het
Fmo3 T C 1: 162,958,332 K363R possibly damaging Het
Gadd45gip1 A T 8: 84,832,351 R21W probably damaging Het
Galnt4 A G 10: 99,109,964 N517S probably benign Het
Ganc T A 2: 120,433,792 W409R probably damaging Het
Glrx3 T C 7: 137,459,191 S185P probably damaging Het
Gm49368 T C 7: 128,113,242 S853P probably damaging Het
Gtf3c2 A C 5: 31,168,267 L443V probably damaging Het
Gxylt2 A T 6: 100,804,528 Q388L probably benign Het
Hcar2 C T 5: 123,865,333 V36M possibly damaging Het
Ifit3b A T 19: 34,612,555 D377V possibly damaging Het
Ints5 A G 19: 8,896,804 D709G probably benign Het
Lyst A G 13: 13,669,865 E1880G probably benign Het
Mep1a C T 17: 43,479,174 S428N probably benign Het
Mllt6 T C 11: 97,676,964 L739P probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Mmel1 T C 4: 154,871,654 M1T probably null Het
Muc5ac C T 7: 141,809,383 P2144S unknown Het
Myh4 T C 11: 67,240,930 V72A probably benign Het
Naa15 T A 3: 51,469,974 probably null Het
Nlrc5 A G 8: 94,521,400 probably null Het
Nme8 T A 13: 19,650,975 M514L probably benign Het
Nudt9 C A 5: 104,047,080 S14* probably null Het
Olfr538 T C 7: 140,574,246 F31S probably damaging Het
Olfr748 A T 14: 50,710,758 I143F possibly damaging Het
Optn G A 2: 5,054,650 T19I probably benign Het
Osbpl8 T A 10: 111,276,509 L495* probably null Het
Panx2 T C 15: 89,067,770 S147P possibly damaging Het
Pclo T A 5: 14,680,616 V3044D unknown Het
Pcnt T C 10: 76,422,808 K608E probably benign Het
Pde7a T A 3: 19,227,745 N447I probably damaging Het
Peli2 G T 14: 48,280,034 C186F not run Het
Pgm5 A G 19: 24,727,851 F433L probably benign Het
Plce1 G A 19: 38,748,433 V1588I probably benign Het
Plin4 T A 17: 56,102,413 H1295L probably benign Het
Poli T C 18: 70,525,519 E134G probably benign Het
Pramef6 T A 4: 143,897,801 D42V probably benign Het
Ptprq T A 10: 107,643,978 I1144F probably damaging Het
Ptprz1 A T 6: 23,024,978 T1738S probably damaging Het
Pxdc1 A G 13: 34,652,284 L51P probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhd T A 4: 134,884,509 probably null Het
Rpp14 T C 14: 8,090,453 S126P probably damaging Het
Sdr39u1 G A 14: 55,897,734 R251* probably null Het
Sephs2 G T 7: 127,273,334 P196T possibly damaging Het
Slc22a16 T C 10: 40,574,089 Y195H possibly damaging Het
Spg11 C A 2: 122,068,880 V1575F probably damaging Het
Sqle C T 15: 59,316,041 S66L probably benign Het
Tas2r124 T G 6: 132,755,093 W122G probably damaging Het
Tex52 A T 6: 128,384,958 probably null Het
Thoc1 T A 18: 9,993,454 C604* probably null Het
Tmc3 T C 7: 83,597,458 S136P probably damaging Het
Tmem212 T A 3: 27,896,313 T11S probably benign Het
Ubn2 A G 6: 38,491,792 N1147S probably benign Het
Uggt2 A G 14: 119,075,347 I350T probably damaging Het
Ust A T 10: 8,207,575 Y346N probably damaging Het
Vwa8 A G 14: 79,098,300 T1399A probably benign Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp800 C A 6: 28,244,194 K257N probably damaging Het
Zfp985 T A 4: 147,582,874 D66E probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
alert UTSW 2 66680246 nonsense probably null
glimmer UTSW 2 66743703 missense probably damaging 0.96
Uptick UTSW 2 66700049 nonsense probably null
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 splice site probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7914:Scn7a UTSW 2 66699950 missense probably damaging 0.97
R7953:Scn7a UTSW 2 66757326 missense possibly damaging 0.90
R7970:Scn7a UTSW 2 66675829 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
R8121:Scn7a UTSW 2 66700859 missense probably damaging 1.00
R8172:Scn7a UTSW 2 66675847 missense possibly damaging 0.90
R8209:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8226:Scn7a UTSW 2 66700860 missense possibly damaging 0.88
R8288:Scn7a UTSW 2 66675974 missense probably damaging 1.00
R8431:Scn7a UTSW 2 66703820 missense possibly damaging 0.62
R8678:Scn7a UTSW 2 66743697 splice site probably benign
R8745:Scn7a UTSW 2 66680182 missense probably benign
R8781:Scn7a UTSW 2 66737431 missense probably benign 0.03
R8848:Scn7a UTSW 2 66700049 nonsense probably null
R8878:Scn7a UTSW 2 66675855 missense probably damaging 1.00
R8943:Scn7a UTSW 2 66694862 synonymous silent
R8991:Scn7a UTSW 2 66684244 missense possibly damaging 0.65
R9147:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9148:Scn7a UTSW 2 66684163 missense possibly damaging 0.89
R9402:Scn7a UTSW 2 66680112 missense probably damaging 1.00
R9501:Scn7a UTSW 2 66752235 missense probably benign 0.00
R9546:Scn7a UTSW 2 66752259 missense possibly damaging 0.93
R9715:Scn7a UTSW 2 66689558 missense possibly damaging 0.93
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTCAAACCTGTTCCACAC -3'
(R):5'- CGCCATCTTTGGAATGTACAAC -3'

Sequencing Primer
(F):5'- AAAGTCATCTTCACTCAAGGTCCTG -3'
(R):5'- CTTTGCCTATGTAAAGAAAGAAGCCG -3'
Posted On 2019-11-12