Incidental Mutation 'R7685:Ganc'
ID592983
Institutional Source Beutler Lab
Gene Symbol Ganc
Ensembl Gene ENSMUSG00000062646
Gene Nameglucosidase, alpha; neutral C
Synonyms5830445O15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.657) question?
Stock #R7685 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120403896-120461700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120433792 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 409 (W409R)
Ref Sequence ENSEMBL: ENSMUSP00000116898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135074]
Predicted Effect probably damaging
Transcript: ENSMUST00000135074
AA Change: W409R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116898
Gene: ENSMUSG00000062646
AA Change: W409R

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
Pfam:Gal_mutarotas_2 221 292 2.3e-21 PFAM
Pfam:Glyco_hydro_31 333 778 2.5e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik C A 2: 92,383,472 P68Q probably damaging Het
Abcg3 A G 5: 104,968,215 L251S probably damaging Het
Acsbg1 C T 9: 54,628,559 S53N unknown Het
Adamts18 A G 8: 113,713,223 C913R probably damaging Het
Adck5 C A 15: 76,595,388 Y524* probably null Het
Adgrv1 G T 13: 81,103,324 Q6225K possibly damaging Het
Ahr T C 12: 35,504,017 N701S probably damaging Het
Apc T C 18: 34,314,208 C1386R probably damaging Het
Bbs1 A G 19: 4,906,154 S38P probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,153 probably benign Het
BC028528 TGGTTCTGTGGTCACTGGTTCTGTGGTCAC TGGTTCTGTGGTCACCGGTTCTGTGGTCACTGGTTCTGTGGTCAC 3: 95,888,156 probably benign Het
BC028528 CACTGGTT CACTGGTTATGTGGTAACTGGTT 3: 95,888,183 probably null Het
Celsr1 G T 15: 85,978,732 C1366* probably null Het
Cep290 A C 10: 100,540,057 H1424P probably benign Het
Clcn3 C T 8: 60,933,085 R311K possibly damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dhx9 A G 1: 153,458,406 Y1002H probably damaging Het
Dnah8 C T 17: 30,657,973 T533I probably damaging Het
Ermard T C 17: 15,059,462 S505P probably benign Het
Fbxw17 G A 13: 50,425,644 D166N probably damaging Het
Fmo3 T C 1: 162,958,332 K363R possibly damaging Het
Gadd45gip1 A T 8: 84,832,351 R21W probably damaging Het
Galnt4 A G 10: 99,109,964 N517S probably benign Het
Glrx3 T C 7: 137,459,191 S185P probably damaging Het
Gm49368 T C 7: 128,113,242 S853P probably damaging Het
Gtf3c2 A C 5: 31,168,267 L443V probably damaging Het
Gxylt2 A T 6: 100,804,528 Q388L probably benign Het
Hcar2 C T 5: 123,865,333 V36M possibly damaging Het
Ifit3b A T 19: 34,612,555 D377V possibly damaging Het
Ints5 A G 19: 8,896,804 D709G probably benign Het
Lyst A G 13: 13,669,865 E1880G probably benign Het
Mep1a C T 17: 43,479,174 S428N probably benign Het
Mllt6 T C 11: 97,676,964 L739P probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Mmel1 T C 4: 154,871,654 M1T probably null Het
Muc5ac C T 7: 141,809,383 P2144S unknown Het
Myh4 T C 11: 67,240,930 V72A probably benign Het
Nme8 T A 13: 19,650,975 M514L probably benign Het
Nudt9 C A 5: 104,047,080 S14* probably null Het
Olfr538 T C 7: 140,574,246 F31S probably damaging Het
Olfr748 A T 14: 50,710,758 I143F possibly damaging Het
Optn G A 2: 5,054,650 T19I probably benign Het
Osbpl8 T A 10: 111,276,509 L495* probably null Het
Panx2 T C 15: 89,067,770 S147P possibly damaging Het
Pclo T A 5: 14,680,616 V3044D unknown Het
Pcnt T C 10: 76,422,808 K608E probably benign Het
Pde7a T A 3: 19,227,745 N447I probably damaging Het
Peli2 G T 14: 48,280,034 C186F not run Het
Pgm5 A G 19: 24,727,851 F433L probably benign Het
Plce1 G A 19: 38,748,433 V1588I probably benign Het
Plin4 T A 17: 56,102,413 H1295L probably benign Het
Poli T C 18: 70,525,519 E134G probably benign Het
Pramef6 T A 4: 143,897,801 D42V probably benign Het
Ptprq T A 10: 107,643,978 I1144F probably damaging Het
Ptprz1 A T 6: 23,024,978 T1738S probably damaging Het
Pxdc1 A G 13: 34,652,284 L51P probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rpp14 T C 14: 8,090,453 S126P probably damaging Het
Scn7a C T 2: 66,676,192 C1451Y probably damaging Het
Sdr39u1 G A 14: 55,897,734 R251* probably null Het
Sephs2 G T 7: 127,273,334 P196T possibly damaging Het
Slc22a16 T C 10: 40,574,089 Y195H possibly damaging Het
Spg11 C A 2: 122,068,880 V1575F probably damaging Het
Sqle C T 15: 59,316,041 S66L probably benign Het
Tas2r124 T G 6: 132,755,093 W122G probably damaging Het
Thoc1 T A 18: 9,993,454 C604* probably null Het
Tmc3 T C 7: 83,597,458 S136P probably damaging Het
Tmem212 T A 3: 27,896,313 T11S probably benign Het
Ubn2 A G 6: 38,491,792 N1147S probably benign Het
Uggt2 A G 14: 119,075,347 I350T probably damaging Het
Ust A T 10: 8,207,575 Y346N probably damaging Het
Vwa8 A G 14: 79,098,300 T1399A probably benign Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp800 C A 6: 28,244,194 K257N probably damaging Het
Zfp985 T A 4: 147,582,874 D66E probably benign Het
Other mutations in Ganc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Ganc APN 2 120441598 missense probably damaging 1.00
IGL00913:Ganc APN 2 120439452 splice site probably benign
IGL01077:Ganc APN 2 120446515 missense possibly damaging 0.50
IGL01773:Ganc APN 2 120459884 missense possibly damaging 0.87
IGL01812:Ganc APN 2 120411526 missense probably benign 0.00
IGL02029:Ganc APN 2 120459857 missense probably benign 0.00
IGL02067:Ganc APN 2 120406304 missense probably benign 0.16
IGL02290:Ganc APN 2 120448423 missense possibly damaging 0.90
IGL02355:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02362:Ganc APN 2 120433757 missense probably damaging 1.00
IGL02553:Ganc APN 2 120458134 missense probably benign
IGL02808:Ganc APN 2 120411511 missense probably benign 0.00
IGL02966:Ganc APN 2 120433648 missense probably damaging 1.00
IGL03356:Ganc APN 2 120435288 missense probably benign 0.22
IGL03405:Ganc APN 2 120433766 missense probably damaging 1.00
ingenuous UTSW 2 120444149 missense probably damaging 1.00
R0464:Ganc UTSW 2 120436694 missense probably benign 0.07
R0511:Ganc UTSW 2 120448401 nonsense probably null
R0932:Ganc UTSW 2 120458129 missense probably damaging 0.99
R1467:Ganc UTSW 2 120430928 splice site probably benign
R1902:Ganc UTSW 2 120446482 missense probably damaging 1.00
R2087:Ganc UTSW 2 120457257 missense probably damaging 1.00
R4668:Ganc UTSW 2 120431067 missense probably benign 0.02
R4669:Ganc UTSW 2 120431067 missense probably benign 0.02
R4725:Ganc UTSW 2 120435273 missense probably damaging 0.99
R4735:Ganc UTSW 2 120436623 splice site silent
R4738:Ganc UTSW 2 120452594 missense probably damaging 0.97
R4839:Ganc UTSW 2 120459823 missense probably benign
R4951:Ganc UTSW 2 120456047 missense probably benign 0.00
R5841:Ganc UTSW 2 120411539 missense possibly damaging 0.65
R5997:Ganc UTSW 2 120430605 missense possibly damaging 0.55
R6142:Ganc UTSW 2 120430737 critical splice donor site probably null
R6378:Ganc UTSW 2 120433826 missense probably damaging 1.00
R6711:Ganc UTSW 2 120450839 missense possibly damaging 0.74
R6777:Ganc UTSW 2 120444149 missense probably damaging 1.00
R7229:Ganc UTSW 2 120427775 missense possibly damaging 0.92
R7235:Ganc UTSW 2 120433717 missense probably damaging 1.00
R7241:Ganc UTSW 2 120441529 missense probably damaging 1.00
R7326:Ganc UTSW 2 120430599 missense probably damaging 1.00
R7567:Ganc UTSW 2 120456101 missense probably benign 0.01
R7736:Ganc UTSW 2 120433814 missense possibly damaging 0.83
R7784:Ganc UTSW 2 120436668 nonsense probably null
X0027:Ganc UTSW 2 120448450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTCTTTTAGGCACACAAGC -3'
(R):5'- TCTTGAACATGGAAAGGTCTCAGG -3'

Sequencing Primer
(F):5'- GCACACAAGCCATGCCC -3'
(R):5'- CTGGCTGCTCTTAAAGAAACCTGG -3'
Posted On2019-11-12