Incidental Mutation 'R0240:Ece1'
ID 59299
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Name endothelin converting enzyme 1
Synonyms
MMRRC Submission 038478-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.800) question?
Stock # R0240 (G1)
Quality Score 221
Status Validated
Chromosome 4
Chromosomal Location 137589548-137692540 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 137676746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000102518
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (112/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 123,506,920 (GRCm39) L71P probably damaging Het
Adamts2 A T 11: 50,666,201 (GRCm39) D399V probably damaging Het
Adck2 T A 6: 39,560,752 (GRCm39) V380E probably benign Het
Alg11 T A 8: 22,555,468 (GRCm39) V243D possibly damaging Het
Ankrd27 T A 7: 35,318,864 (GRCm39) L585Q probably damaging Het
Armh4 A G 14: 50,005,859 (GRCm39) probably benign Het
Atp7a T A X: 105,153,447 (GRCm39) N1117K probably damaging Het
Bltp3a T A 17: 28,114,844 (GRCm39) probably benign Het
Cacna1b G A 2: 24,528,669 (GRCm39) probably benign Het
Cacna1d T A 14: 29,818,926 (GRCm39) M1210L probably benign Het
Cacna1s T C 1: 136,001,234 (GRCm39) probably benign Het
Chd7 T C 4: 8,852,670 (GRCm39) probably benign Het
Col12a1 A T 9: 79,559,315 (GRCm39) S1858T probably benign Het
Cotl1 C T 8: 120,567,063 (GRCm39) W26* probably null Het
Csmd3 T C 15: 47,492,635 (GRCm39) T3000A probably benign Het
Dcp1a T A 14: 30,206,551 (GRCm39) probably benign Het
Ddhd2 A T 8: 26,229,617 (GRCm39) probably null Het
Dnah8 T C 17: 30,984,653 (GRCm39) I3117T probably damaging Het
Dnm3 G T 1: 162,181,194 (GRCm39) Q162K probably benign Het
Dpy19l2 G T 9: 24,569,876 (GRCm39) A359D probably damaging Het
Eif4g3 A G 4: 137,897,873 (GRCm39) K1025R probably damaging Het
Eml2 C A 7: 18,918,797 (GRCm39) Y82* probably null Het
Eml6 A G 11: 29,742,367 (GRCm39) V1057A possibly damaging Het
Eral1 A G 11: 77,966,884 (GRCm39) probably benign Het
Espl1 T C 15: 102,220,976 (GRCm39) S911P probably benign Het
Fbxo8 A G 8: 57,043,296 (GRCm39) probably benign Het
Flrt1 A T 19: 7,074,475 (GRCm39) probably benign Het
Fndc7 A G 3: 108,766,235 (GRCm39) probably benign Het
G3bp1 G A 11: 55,382,854 (GRCm39) G139D probably damaging Het
Gabra6 C T 11: 42,205,774 (GRCm39) V351I probably benign Het
Galc A T 12: 98,218,293 (GRCm39) H186Q probably damaging Het
Ganab A G 19: 8,890,177 (GRCm39) D702G possibly damaging Het
Hdac10 T C 15: 89,010,085 (GRCm39) E291G possibly damaging Het
Hectd3 T G 4: 116,859,810 (GRCm39) V749G probably damaging Het
Kash5 C T 7: 44,849,675 (GRCm39) A83T probably benign Het
Kcnh1 T A 1: 192,187,648 (GRCm39) I703N probably benign Het
Kcnma1 G A 14: 23,544,647 (GRCm39) T505I probably damaging Het
Kctd11 A G 11: 69,770,640 (GRCm39) C133R probably damaging Het
Lama3 A T 18: 12,672,880 (GRCm39) probably null Het
Lamb3 T C 1: 193,017,335 (GRCm39) L842P probably damaging Het
Ldlr T C 9: 21,649,295 (GRCm39) probably benign Het
Lipk G A 19: 34,024,210 (GRCm39) R336H probably benign Het
Lrrc24 T A 15: 76,607,409 (GRCm39) D58V probably damaging Het
Lrsam1 A G 2: 32,845,197 (GRCm39) L106P probably damaging Het
Milr1 G A 11: 106,645,722 (GRCm39) W88* probably null Het
Mmp10 A G 9: 7,506,544 (GRCm39) D340G probably damaging Het
Mybpc1 T A 10: 88,391,600 (GRCm39) Y285F possibly damaging Het
Ncoa3 A G 2: 165,896,320 (GRCm39) T408A probably benign Het
Nefm T A 14: 68,358,583 (GRCm39) K484* probably null Het
Nfasc A G 1: 132,529,721 (GRCm39) S814P probably damaging Het
Nlrp4a T C 7: 26,161,941 (GRCm39) V863A probably benign Het
Nos1 C T 5: 118,005,948 (GRCm39) P223S probably benign Het
Nr2f2 G C 7: 70,009,923 (GRCm39) P52R probably damaging Het
Or13c7 T A 4: 43,854,512 (GRCm39) S68T probably damaging Het
Or4c108 A T 2: 88,803,740 (GRCm39) L165Q probably damaging Het
Or5an6 A T 19: 12,372,327 (GRCm39) E233D probably benign Het
Or8k41 A G 2: 86,313,730 (GRCm39) S119P possibly damaging Het
Osbpl5 T C 7: 143,295,406 (GRCm39) probably null Het
Otog C A 7: 45,913,456 (GRCm39) probably null Het
Pacs1 A T 19: 5,206,402 (GRCm39) I261N possibly damaging Het
Pbx1 G A 1: 168,031,051 (GRCm39) T189I possibly damaging Het
Pcnx1 T C 12: 81,993,792 (GRCm39) I908T possibly damaging Het
Pdxdc1 A T 16: 13,697,309 (GRCm39) W124R probably damaging Het
Phex C A X: 155,969,214 (GRCm39) D587Y probably damaging Het
Plcb3 A T 19: 6,940,363 (GRCm39) D435E probably benign Het
Plce1 A C 19: 38,717,330 (GRCm39) K1373T probably damaging Het
Prkcd G A 14: 30,324,045 (GRCm39) A311V probably damaging Het
Ptpn3 A T 4: 57,232,374 (GRCm39) S421T probably benign Het
Ptprs T C 17: 56,743,087 (GRCm39) probably null Het
Qrich1 A G 9: 108,411,333 (GRCm39) D286G probably damaging Het
Rcc1 C A 4: 132,060,226 (GRCm39) G393V probably damaging Het
Reln T C 5: 22,311,043 (GRCm39) N290S probably benign Het
Rgl1 T C 1: 152,430,175 (GRCm39) probably benign Het
Rhpn1 C T 15: 75,585,971 (GRCm39) T628I probably benign Het
Rilp A G 11: 75,401,747 (GRCm39) R176G probably benign Het
Riok3 C T 18: 12,288,284 (GRCm39) A487V probably benign Het
Rnf224 T C 2: 25,126,219 (GRCm39) T45A probably damaging Het
Rpa1 A G 11: 75,219,513 (GRCm39) V137A probably benign Het
Rps6ka1 C A 4: 133,575,842 (GRCm39) Q693H probably benign Het
Scn2a G T 2: 65,566,118 (GRCm39) V1381F probably benign Het
Scp2 T A 4: 107,955,275 (GRCm39) H112L probably benign Het
Sdk1 T C 5: 141,984,502 (GRCm39) W696R probably damaging Het
Slc26a7 C A 4: 14,532,651 (GRCm39) V408F probably damaging Het
Slc28a2 T A 2: 122,285,008 (GRCm39) I332N probably benign Het
Slc37a3 A G 6: 39,314,172 (GRCm39) V480A probably benign Het
Slc45a4 T A 15: 73,453,755 (GRCm39) E674D probably benign Het
Smpd3 T C 8: 106,991,788 (GRCm39) E255G probably damaging Het
Snx29 C T 16: 11,478,417 (GRCm39) R658W probably damaging Het
Sppl2a A T 2: 126,762,256 (GRCm39) M275K probably benign Het
Stac T C 9: 111,464,089 (GRCm39) N59S probably damaging Het
Stk25 A T 1: 93,554,782 (GRCm39) L131Q probably damaging Het
Tep1 C T 14: 51,100,486 (GRCm39) probably benign Het
Thbs1 C A 2: 117,944,874 (GRCm39) N229K probably damaging Het
Tmx2 A T 2: 84,506,186 (GRCm39) H89Q probably damaging Het
Tnfrsf21 C T 17: 43,349,104 (GRCm39) H239Y probably benign Het
Tradd T C 8: 105,985,924 (GRCm39) N209S possibly damaging Het
Trappc3l A T 10: 33,974,928 (GRCm39) R119* probably null Het
Trmt1l G A 1: 151,333,205 (GRCm39) probably benign Het
Ublcp1 G T 11: 44,349,104 (GRCm39) Y243* probably null Het
Usp24 C A 4: 106,271,601 (GRCm39) C2158* probably null Het
Usp34 A T 11: 23,383,206 (GRCm39) K2088N probably damaging Het
Vmn1r53 G C 6: 90,200,925 (GRCm39) S133C probably damaging Het
Vmn2r52 A G 7: 9,893,327 (GRCm39) V604A probably damaging Het
Vmn2r93 A G 17: 18,525,061 (GRCm39) K240E probably benign Het
Wdr13 T G X: 7,994,284 (GRCm39) D242A probably damaging Het
Wwp1 C T 4: 19,641,734 (GRCm39) probably null Het
Zan G A 5: 137,396,624 (GRCm39) H4311Y unknown Het
Zc3h12c C A 9: 52,055,383 (GRCm39) R123L possibly damaging Het
Zfp125 A T 12: 20,950,562 (GRCm39) noncoding transcript Het
Zfp318 C T 17: 46,707,739 (GRCm39) P266S probably benign Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137,665,969 (GRCm39) missense probably damaging 1.00
IGL01538:Ece1 APN 4 137,675,855 (GRCm39) missense probably benign
IGL01588:Ece1 APN 4 137,684,517 (GRCm39) splice site probably benign
IGL01678:Ece1 APN 4 137,690,044 (GRCm39) missense probably damaging 1.00
IGL02619:Ece1 APN 4 137,666,044 (GRCm39) missense probably benign 0.08
IGL02936:Ece1 APN 4 137,673,612 (GRCm39) missense probably benign 0.01
IGL02956:Ece1 APN 4 137,690,149 (GRCm39) missense probably damaging 0.99
IGL03332:Ece1 APN 4 137,673,666 (GRCm39) missense probably damaging 0.99
R0063:Ece1 UTSW 4 137,675,892 (GRCm39) missense probably benign 0.14
R1004:Ece1 UTSW 4 137,653,550 (GRCm39) missense probably benign 0.04
R1515:Ece1 UTSW 4 137,678,819 (GRCm39) missense probably benign 0.00
R1541:Ece1 UTSW 4 137,675,971 (GRCm39) splice site probably null
R1796:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1834:Ece1 UTSW 4 137,685,439 (GRCm39) missense probably damaging 0.99
R1834:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1836:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1930:Ece1 UTSW 4 137,666,074 (GRCm39) missense probably benign 0.01
R1931:Ece1 UTSW 4 137,666,074 (GRCm39) missense probably benign 0.01
R2065:Ece1 UTSW 4 137,685,393 (GRCm39) missense probably benign 0.04
R2281:Ece1 UTSW 4 137,673,673 (GRCm39) missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137,675,855 (GRCm39) missense probably benign
R4720:Ece1 UTSW 4 137,684,486 (GRCm39) missense probably damaging 1.00
R4773:Ece1 UTSW 4 137,672,464 (GRCm39) missense probably benign 0.00
R5794:Ece1 UTSW 4 137,683,844 (GRCm39) missense probably damaging 0.99
R5969:Ece1 UTSW 4 137,689,051 (GRCm39) critical splice donor site probably null
R6056:Ece1 UTSW 4 137,688,958 (GRCm39) missense probably damaging 1.00
R6332:Ece1 UTSW 4 137,685,319 (GRCm39) missense probably damaging 1.00
R6648:Ece1 UTSW 4 137,648,470 (GRCm39) missense probably benign 0.00
R7285:Ece1 UTSW 4 137,641,074 (GRCm39) splice site probably null
R7387:Ece1 UTSW 4 137,666,095 (GRCm39) missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
R8294:Ece1 UTSW 4 137,675,931 (GRCm39) missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137,664,075 (GRCm39) missense probably damaging 0.99
R8806:Ece1 UTSW 4 137,672,452 (GRCm39) missense probably damaging 1.00
R9578:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
X0063:Ece1 UTSW 4 137,653,686 (GRCm39) missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137,648,338 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTGAAAGTCTGCCTCATCTTGAGCC -3'
(R):5'- TGTCTCCTGACACTATGCCACTGG -3'

Sequencing Primer
(F):5'- ATCTTGAGCCCAGTTCTGTTAG -3'
(R):5'- ACATGCTCACTGTCAGAGG -3'
Posted On 2013-07-11