Incidental Mutation 'R7685:Slc22a16'
ID593016
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7685 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40574089 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 195 (Y195H)
Ref Sequence ENSEMBL: ENSMUSP00000019978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019978
AA Change: Y195H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834
AA Change: Y195H

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078314
AA Change: Y174H

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834
AA Change: Y174H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik C A 2: 92,383,472 P68Q probably damaging Het
Abcg3 A G 5: 104,968,215 L251S probably damaging Het
Acsbg1 C T 9: 54,628,559 S53N unknown Het
Adamts18 A G 8: 113,713,223 C913R probably damaging Het
Adck5 C A 15: 76,595,388 Y524* probably null Het
Adgrv1 G T 13: 81,103,324 Q6225K possibly damaging Het
Ahr T C 12: 35,504,017 N701S probably damaging Het
Apc T C 18: 34,314,208 C1386R probably damaging Het
Bbs1 A G 19: 4,906,154 S38P probably benign Het
Celsr1 G T 15: 85,978,732 C1366* probably null Het
Cep290 A C 10: 100,540,057 H1424P probably benign Het
Clcn3 C T 8: 60,933,085 R311K possibly damaging Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Dhx9 A G 1: 153,458,406 Y1002H probably damaging Het
Dnah8 C T 17: 30,657,973 T533I probably damaging Het
Ermard T C 17: 15,059,462 S505P probably benign Het
Fbxw17 G A 13: 50,425,644 D166N probably damaging Het
Fmo3 T C 1: 162,958,332 K363R possibly damaging Het
Gadd45gip1 A T 8: 84,832,351 R21W probably damaging Het
Galnt4 A G 10: 99,109,964 N517S probably benign Het
Ganc T A 2: 120,433,792 W409R probably damaging Het
Glrx3 T C 7: 137,459,191 S185P probably damaging Het
Gm49368 T C 7: 128,113,242 S853P probably damaging Het
Gtf3c2 A C 5: 31,168,267 L443V probably damaging Het
Gxylt2 A T 6: 100,804,528 Q388L probably benign Het
Hcar2 C T 5: 123,865,333 V36M possibly damaging Het
Ifit3b A T 19: 34,612,555 D377V possibly damaging Het
Ints5 A G 19: 8,896,804 D709G probably benign Het
Lyst A G 13: 13,669,865 E1880G probably benign Het
Mep1a C T 17: 43,479,174 S428N probably benign Het
Mllt6 T C 11: 97,676,964 L739P probably damaging Het
Mlst8 T C 17: 24,476,057 Y284C probably damaging Het
Mmel1 T C 4: 154,871,654 M1T probably null Het
Muc5ac C T 7: 141,809,383 P2144S unknown Het
Myh4 T C 11: 67,240,930 V72A probably benign Het
Naa15 T A 3: 51,469,974 probably null Het
Nlrc5 A G 8: 94,521,400 probably null Het
Nme8 T A 13: 19,650,975 M514L probably benign Het
Nudt9 C A 5: 104,047,080 S14* probably null Het
Olfr538 T C 7: 140,574,246 F31S probably damaging Het
Olfr748 A T 14: 50,710,758 I143F possibly damaging Het
Optn G A 2: 5,054,650 T19I probably benign Het
Osbpl8 T A 10: 111,276,509 L495* probably null Het
Panx2 T C 15: 89,067,770 S147P possibly damaging Het
Pclo T A 5: 14,680,616 V3044D unknown Het
Pcnt T C 10: 76,422,808 K608E probably benign Het
Pde7a T A 3: 19,227,745 N447I probably damaging Het
Peli2 G T 14: 48,280,034 C186F not run Het
Pgm5 A G 19: 24,727,851 F433L probably benign Het
Plce1 G A 19: 38,748,433 V1588I probably benign Het
Plin4 T A 17: 56,102,413 H1295L probably benign Het
Poli T C 18: 70,525,519 E134G probably benign Het
Pramef6 T A 4: 143,897,801 D42V probably benign Het
Ptprq T A 10: 107,643,978 I1144F probably damaging Het
Ptprz1 A T 6: 23,024,978 T1738S probably damaging Het
Pxdc1 A G 13: 34,652,284 L51P probably damaging Het
Rabepk C T 2: 34,779,296 G362S probably damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rhd T A 4: 134,884,509 probably null Het
Rpp14 T C 14: 8,090,453 S126P probably damaging Het
Scn7a C T 2: 66,676,192 C1451Y probably damaging Het
Sdr39u1 G A 14: 55,897,734 R251* probably null Het
Sephs2 G T 7: 127,273,334 P196T possibly damaging Het
Spg11 C A 2: 122,068,880 V1575F probably damaging Het
Sqle C T 15: 59,316,041 S66L probably benign Het
Tas2r124 T G 6: 132,755,093 W122G probably damaging Het
Tex52 A T 6: 128,384,958 probably null Het
Thoc1 T A 18: 9,993,454 C604* probably null Het
Tmc3 T C 7: 83,597,458 S136P probably damaging Het
Tmem212 T A 3: 27,896,313 T11S probably benign Het
Ubn2 A G 6: 38,491,792 N1147S probably benign Het
Uggt2 A G 14: 119,075,347 I350T probably damaging Het
Ust A T 10: 8,207,575 Y346N probably damaging Het
Vwa8 A G 14: 79,098,300 T1399A probably benign Het
Zc3h18 G A 8: 122,413,876 R850Q unknown Het
Zfp800 C A 6: 28,244,194 K257N probably damaging Het
Zfp985 T A 4: 147,582,874 D66E probably benign Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R6738:Slc22a16 UTSW 10 40585302 missense probably damaging 0.99
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
R7883:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
R7966:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
RF004:Slc22a16 UTSW 10 40603646 missense possibly damaging 0.94
Z1177:Slc22a16 UTSW 10 40585156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGGAACTCACGAGATGTAGC -3'
(R):5'- CCACTGTGTTACTCTGCGTG -3'

Sequencing Primer
(F):5'- CACGTCACATTTGGGCTATGAGTAC -3'
(R):5'- CTGCGTGCCTAACTGATGGATC -3'
Posted On2019-11-12